Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co

descargar 64.55 Kb.
títuloResumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co
fecha de publicación21.01.2016
tamaño64.55 Kb.
tipoResumen > Biología > Resumen


En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los ORFs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más concreto de su función, estructura, etc. mediante diversos programas informáticos

El género Rhodococcus pertenece a un grupo de microorganismos aerobios de alto contenido en G+C . Son bacterias Gram posisitivas, no esporuladas que se han encontrado ampliamente distribuidos en el medio ambiente y sobre todo en suelos, reservorios de aguas, ríos, lagos y otros ambientes acuáticos. Se ha encontrado que este grupo de bacterias está relacionado con Mycobacterium, Corynebacterium,Nocardia y Gordonia.
En cuanto a su clasificación taxonómica:

-Clase Actinobacteria

-Subclase Actinobacteridae

-Orden Actinomycetales

-Suborden Corynebarterineae,

-Familia Nocardiaceae

-Género Rhodococcus.

Analizando la secuencia de 17000 pb mediante el programa informático Artemis se obtuvieron los distintos ORFs que codificaban para las distintas proteínas de la bacteria.

Fig.1.Obtención de los ORFs de la secuencia mediante el programa Artemio.
De esta manera elegimos la proteína Lysyl-tRNA synthetase. La secuencia de esta proteína es la siguiente:


La lisil-tRNA sintetasa es una proteína específica que cataliza la primera reacción que sufren los aminoácidos para intervenir en la biosíntesis de proteínas que es la unión al tRNA, en este caso, a la lisina. Por tanto se trata de una proteína importante para la síntesis de proteínas en Rhodococcus.

Mediante diversos programas informáticos se analizaron distintos aspectos de la proteína.


M P P S S S L A P N G P S T P H T G L G E T T V T G R T S M A T S T G S P V D T T D R R D H H Q T R V T P K R G R L S E V P H I A G L V L G V F S V L V F L W S L S P A L R Y L V H T P R L Y I D D Y Y F D A P D T S L S W A V V V G L V A A A L A S R K R I A W W L L T I Y L T L F A V L N A V T A V A D E N V N A A V A C V V Q L A V V G I L I A A R K E F Y T R V R R G A A W K A L G V L V S G L A V G T L L G W G L V E L F P G T L P S G Q R F L W A L N R V T A L V V V E N E Q F D G H P H V F V N T L L G L F G A L A L L A A V I T L F R S Q R A S N A L T G D D E S A L R G L L D S F G A D D S L G Y F A T R R D K A V V F A P S G K A A V T Y R V E I G V C L A S G D P I G N P E A W P H A I D A W L A L C S K Y G W A P A V M G A S E A G A T A Y K R A G L S V L Q L G D E A I L E T R E F N L N G R E M R Q V R Q A V H R V R K Q G V T V R I R R H R D I P P A E M A D V V A R A D A W R D T E T E R G F S M A L G R L G D P L D G D C L L V E A L G E D G T V L G M L S L V P W G P N G A S L D L M R R N P D A P N G V V E L M V T E L A T R S D E F G V V R V S L N F A V F R S T F E E G A R I G A G P I L R V W R S M L L F F S R W W Q L E A L Y R S N V K Y Q P E W A P R Y L C F D D N R Q L P R V G I A S A I A E G F L T L P T F G H R A K A P T H T G T R A A V P A A L A V S G V L H A D G S A P D A A A P A A D A P T G R T D G T A P E S V G P R R P E Q V R V R M D K L A R L A D E G I D P Y P V A Y P P T H T V A A A T S S P E G T R V R I A G R L L R I R T Y G G V A F A V L R D W S G D I Q V L I E R T T V G D R L D E F S T D F D L G D L M E V S G T I G R S R K G E L S L L A T E W R M N G K C L H P L P D K W K G L T D A E T R V R Q R Y V D L A I N P E S R R L L A A R T A I V K S L R D T L A G R D Y L E V E T P I L Q R I H G G A N A A P F V T H I N A Y D L D L Y L R I A P E L F L K R L C V A G M E K V F E I G R V F R N E G V D F K H N P E F T I L E A Y E A H S D Y E R M M V L C R E L I Q A A A V A A H G S Q T I M R P G P D G E L V A V D I S G E W P V K T M H G A V A E K L G V D V S P E T P L E V L Q K L C D E N D I E Y Q K S W D A G A V A Q E M Y E H L V E G Q T E F P T F Y T N F P T S M S P L T R P H P T I P G V A A K W D L V A W G V E L G T A Y S E L T D P I D Q R R R L T E Q S L L A A G G D A E A M E L D E D F L Q A L E H A M P P T G G L G M G V D R I V M L I T G G S I R E S L A F P F A K P R N Stop


Temperatura = 93ºC


El contenido en G+C de la proteína es de 70%


El peso molecular de la proteína es de 1065,126kD


Using the scale Hphob. / Kyte & Doolittle, the individual values for the 20 amino acids are:

Ala: 1.800 Arg: -4.500 Asn: -3.500 Asp: -3.500 Cys: 2.500 Gln: -3.500

Glu: -3.500 Gly: -0.400 His: -3.200 Ile: 4.500 Leu: 3.800 Lys: -3.900

Met: 1.900 Phe: 2.800 Pro: -1.600 Ser: -0.800 Thr: -0.700 Trp: -0.900

Tyr: -1.300 Val: 4.200 : -3.500 : -3.500 : -0.490

Weights for window positions 1,..,9, using linear weight variation model:

1 2 3 4 5 6 7 8 9

1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

edge center edge

MIN: -3.456

MAX: 3.133

Fig. 2. Gráfica que representa la hidrofobicidad


# Sequence Length: 1150

# Sequence Number of predicted TMHs: 5

# Sequence Exp number of AAs in TMHs: 139.22254

# Sequence Exp number, first 60 AAs: 0.46269

# Sequence Total prob of N-in: 0.74927

Sequence TMHMM2.0 inside 1 62

Sequence TMHMM2.0 TMhelix 63 85

Sequence TMHMM2.0 outside 86 99

Sequence TMHMM2.0 TMhelix 100 122

Sequence TMHMM2.0 inside 123 126

Sequence TMHMM2.0 TMhelix 127 149

Sequence TMHMM2.0 outside 150 152

Sequence TMHMM2.0 TMhelix 153 172

Sequence TMHMM2.0 inside 173 184

Sequence TMHMM2.0 TMhelix 185 207

Sequence TMHMM2.0 outside 208 1150

Fig. 3. Dominios transmembrana de la proteína lisil-tRNA sintetasa.

Según esto podemos decir que la proteína tiene varios dominios transmembrana pero que la mayor parte de ella es extracelular.



PRIMER 1: GAATTCatgcctccatcttcctccttg Tm=60ºC

PRIMER 2: GAATTCtcagttgcgcggcttggcg Tm63ºC

El sitio de corte usado para amplificar fue EcoRI

Mediante el programa informático ClustalW2 se realizó el alineamiento de la proteína junto con la de otros cuatro microorganismos. Lo que se obtuvo haciendo esto fue lo siguiente:
[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia ------------------------------------------------------------

[Streptomyces ------------------------------------------------------------

[Rhodococcus ------------------------------------------------------------

[Corynebacterium ------------------------------------------------------------


[Frankia -----------------------------MVDRRDWMTRAADEAIERAQQR-PGGAKVVC 30

[Streptomyces -----------------------MPIVAQSTETTDWVSRFADEVIAESERRAPGKPGVVV 37

[Rhodococcus --------------------------------------MSEVAAQPVDDTP--------- 13

[Corynebacterium -----------------------------------MTNSNPTSKNNSADLP--------- 16




. *





: . . . * . .





. .. .: . :: :: . :
[Rhodococcus DVDLGDFVFVHGEVISSRRGELS---------------------------------VMAD 138

[Corynebacterium DVDMGDIVSVRGKVISSKRGELS---------------------------------VMAD 155

[Rhodococcus] DFDLGDLMEVSGTIGRSRKGELS---------------------------------LLAT 783


[Streptomyces QKPLDEAELEAAE-------GSG---------------------------------AAAE 204

. . . *





. . . : . : . : :





:*: *: . . * . . .: : *. :: . : .. :





: . * . : ::*. * : : :





** : . ::: : * : .





. . . . . * : .





: *. . . * :. : : : : .:





: . * : ::: : :* :
De esta forma vemos los aminoácidos conservados. Para saber, si es o no esencial para mi microorganismo ese gen, se ha elegido un aminoácido conservado, la Leucina de la posición 997.

La Leucina es un aminoácido aminoácido hidrofobico. Estos aminoácidos son menos solubles en el agua que los aminoácidos con grupos R polares.

Si se hace una mutación y cambio la T por una A, obtengo un aminoácido hidrofílico, glutamina: CAG

PRIMER 1: GAATTC atgcctccatcttcctccttg

PRIMER 2 Mut1: cctcga ggtgCAGcagaagttg Tm=59ºC

PRIMER3:mut2:tcgaggcaacttctgCTGcacc Tm=59ºC

PRIMER 4: GAATTC tcagttgcgcggcttggcg

Para localizar nuestra proteína necesitamos hacer primers para crear una proteína de fusión con la proteína fluorescente verde o también podemos meterlo en el plásmido pGFPuv.

Los primers son los siguientes;
Primer1: GAATTCatgcctccatcttcctccttg Tm= 60ºC
Primer 2: cttctcctttactcat gttgcgcggcttg Tm:63ºC
Primer 3: gccgcgcaac atgagttaaaggagaagaac Tm=63ºC
Primer 4: GAATTC ttatttgtatag ttc atccatg ccatg tg Tm=60ºC

El plásmido de fusión pGFPuv utilizado es el siguiente:


Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen En este trabajo se presenta un análisis acerca de la identidad...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen el presente trabajo de investigación, consiste en el análisis...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen: El trabajo planteado se centrará en el estudio de una de...
«Vivimos en un círculo extraño, cuyo centro está en todas partes y su circunferencia en ninguna»

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconEn clase de cmc de 1º De Bachillerato, los alumnos realizan la secuenciación...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconEl estudio de la motivación está interesado, en primer lugar, en...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen La enseñanza por medio del estudio o análisis de casos es...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen El objetivo de este artículo es realizar un análisis conceptual...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconEn el Chicago distópico de Beatrice Prior, la sociedad está dividida...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen En este trabajo investigaremos sobre los distintos tipos...

Resumen: En este trabajo se nos ha encargado el análisis de una secuencia de 17000pb de un microorganismo desconocido. Mediante el Programa informático Artemis se obtuvieron los orfs que codificaban paras las distintas proteínas y de esta manera se eligió una de ellas para realizar un estudio más co iconResumen nuestro trabajo consiste en crear una nueva raza de cuyes...

Todos los derechos reservados. Copyright © 2015