Selección natural




descargar 40.88 Kb.
títuloSelección natural
fecha de publicación23.01.2016
tamaño40.88 Kb.
tipoLección
b.se-todo.com > Biología > Lección
Genética molecular

La genética estudia la herencia de la información biológica. En este tema estudiaremos los fundamentos moleculares de estos procesos, con la intervención de una molécula estrella, el ADN.

La variabilidad: Este concepto hace referencia a las diferencias existentes entre los caracteres de los individuos de una misma población, esto es, aquellos que pertenecen a una misma especie. Sobre dicha variabilidad actúa la selección natural; de manera que los individuos más aptos de una población serán aquellos que dejen más descendientes ya que viven más tiempo, esta situación implica que sus genes serán más abundantes en esa población.

Pero, ¿qué son los genes? Los genes son fragmentos de una molécula de ADN que contienen información sobre un determinado carácter.

Y, ¿qué es el ADN? El ADN es una macromolécula formada por dos cadenas en forma de doble hélice. Cada cadena está formada por la sucesión de 4 piezas moleculares distintas llamadas nucleótidos que vamos a representar con las letras A, C, G,T .

En una molécula de ADN hay miles de estas unidades y una molécula se diferencia de otra por el número y orden en que están colocadas dichas unidades. En definitiva estamos ante una molécula que contiene información para lo cual utiliza diferentes combinaciones de esas 4 letras de forma similar a como combinamos las 28 letras del abecedario para construir o transmitir cualquier mensaje (conversaciones, libros de texto, revistas, etc.).

Partiendo de lo dicho hasta ahora, si por alguna causa se altera la secuencia de nucleótidos de un fragmento de ADN correspondiente con un gen, también se alterará la información que contiene de manera que el carácter que informa cambia. Por ejemplo el gen responsable del color negro del pelo puede sufrir un cambio que se manifiesta en la aparición de una variante de ese carácter, por ejemplo el color rubio. Esto es un ejemplo de variabilidad dentro de la población:

Carácter: color del pelo. Variantes de dicho carácter: negro y rubio.
¿Cómo se expresa la información contenida en el ADN?

El ADN no actúa directamente, sino que transmite la información genética a otras moléculas, los ARN mensajeros (ARNm), una especie de fotocopia simplificada del ADN que contiene la misma información y que se traduce en proteínas. Las proteínas, están formadas por secuencias de aminoácidos y son las responsables de los caracteres de los individuos; por ejemplo un determinado gen contiene información para la síntesis (fabricación) de una enzima responsable de la producción de un pigmento llamado melanina de tal manera que la presencia de este pigmento se manifiesta en un color oscuro del pelo.

En otros casos la relación entre proteína y carácter no es tan directa, pero al final se puede afirmar que un gen determina una proteína y esta a su vez, un carácter. El proceso de expresión se desarrolla según el siguiente esquema, utilizando el llamado código genético.

Expresión de la información genética

Molécula de ADN (2 cadenas)

nucleótidos: A, G, C, T




..ATATCATGCGCGCGAATTTCGTGGGTCAGGCTTGAAG….

..TATAGTACGCGCGCTTAAAGCACC CAGTCCGAACTTC…

Transcripción


(En el núcleo)




En este ejemplo se copiaría la cadena de

abajo, por complementariedad.
..AUAUCAUGCGCGCGAAUUUCGUGGGUCAGGCUUGAAG…..

Molécula de ARN mensajero

(1 cadena). nucleótidos: A, G, C, U

Traducción


(En el citoplasma: ribosomas)

M

Proteína




et
– Arg – Ala – Asn – Phe – Val – Gly – Lys – Gln - Ala


INICIO STOP


Hay que señalar que el ADN se encuentra empaquetado en el interior del núcleo de las células en forma de una sustancia difusa llamada cromatina, cuando la célula se va a dividir la cromática se condensa y aparecen los cromosomas, estructuras diferenciadas formadas por ADN y proteínas empaquetadoras (histonas) y que se encuentran en un número constante en cada especie, por ejemplo las células de los humanos contienen 46 cromosomas (23 proceden de nuestra madre y 23 de nuestro padre).

Esta situación esta recogida en la conocida “TEORÍA CROMOSÓMICA DE LA HERENCIA “ que se resume en el contenido del siguiente cuadro:


Los factores hereditarios

(genes) se localizan en los cromosomas (ADN + Histonas).

El lugar que ocupa un determinado gen en un cromosoma concreto se denomina “locus”(loci plural)

Los “Loci” se encuentran situados linealmente a lo largo del cromosoma.

Las distintas variantes de un mismo gen se llaman alelos

Los alelos se encuentran en los loci de los cromosomas homólogos; por eso existe un par de alelos por carácter.

Los cromosomas se distribuyen equitativamente en la división celular por mitosis o por meiosis.

La meiosis produce gametos

Durante la meiosis se producen intercambios de fragmentos de cromosomas homólogos (recombinación)

El origen de los alelos está en las mutaciones del ADN.



Todas las células del cuerpo humano tienen los mismos genes, sin embargo, no en todas son activos, depende de la especialización de dichas células, así una célula nerviosa activara ciertos genes, diferentes a los que activará una célula muscular.

Cuando la célula se va a dividir necesita transmitir la información genética a las células hijas, de manera que necesita hacer copias del ADN y de esa forma cada célula resultante tendrá su propio ADN. Este proceso se conoce como replicación del ADN, se produce en el núcleo y sigue el llamado modelo semiconservativo que consiste en que cada cadena sirve de molde para la síntesis de una cadena complementaria y nueva. La síntesis consiste en la unión de los nucleótidos que hay en el núcleo a una de las hebras, por complementariedad, la A con la T y la C con la G o viceversa. El resultado final son 2 moléculas de ADN que presentan una cadena original y otra nueva, “conservan la mitad de la molécula original” de ahí el nombre de semiconservativo. La consecuencia citológica inicial es la aparición de cromosomas dobles (con 2 cromátidas que contienen una molécula de ADN cada una).


  1. ¿De dónde obtienen las células de nuestro organismo los nucleótidos para fabricar nuevo ADN? ¿Y el resto de los animales? ¿Y las plantas?

Fuentes de variabilidad:

En principio, las dos moléculas de ADN resultantes de la replicación son idénticas entre sí y con respecto a la molécula inicial. Ahora bien, aunque la fidelidad en el copiado es muy alta, de cuando en cuando se producen errores en la copia, ya sea por alteraciones en el orden de los nucleótidos o por perder o ganar algún nucleótido. Estos errores que se producen al azar provocan el que los genes vayan cambiando con el tiempo. Estos cambios se denominan mutaciones y son la causa de la aparición de variantes de un mismo gen que aunque informan de un mismo carácter (ejemplo color del pelo) lo hacen de diferente manera (ejemplo negro y rubio). Las variante de un mismo gen se denominan ALELOS O GENES ALELOS.

Podemos concluir que el origen de los alelos son las mutaciones y en consecuencia estas son la fuente primaria de variabilidad.

Las mutaciones no siempre se producen espontáneamente durante la replicación, son muchos los agentes externos que pueden ocasionar mutaciones en el ADN, de forma que si las células afectadas son gametos (óvulos o espermatozoides), los cambios se manifestaran en la descendencia. Algunos ejemplos de agentes mutágenos son las radiaciones solares, productos químicos como los benzopirenos producidos en la combustión del tabaco, carnes, etc.

Cuando estas mutaciones afectan al ADN de células somáticas ( no reproductivas), pueden ser el origen de enfermedades como el cáncer.


  1. Imagina que los dos fragmentos siguientes de una molécula de ADN representan, el primero de ellos un gen original y el segundo un gen mutado, y que el primero de ellos determina el color negro del pelo del lobo.


AAATGCGCGCGAATTTCGTGGGTCAGGCTTGAAG

TTTACGCGCGCTTAAAGCTCC CAGTCCGAACTTC
AAATGCGCGCGAGTTTCGTGGGTCAGGCTTGAAG

TTTACGCGCGCT CAAAGCTCC CAGTCCGAACTTC

Localiza la mutación en el segundo gen. Indica la nueva secuencia de aminoácidos resultante de su expresión. Razona en qué condiciones el ejemplo que has puesto sería una mutación beneficiosa o perjudicial.


  1. ¿Qué consecuencias tendría para la evolución, en general, la ausencia de mutaciones? Razónalo.



  1. Después de la Segunda Guerra Mundial se ha generalizado la utilización de antibióticos para controlar las bacterias productoras de enfermedades. Sin embargo, suelen aparecer bacterias que se vuelven resistentes a los antibióticos. ¿Cómo puedes explicar la aparición de esta resistencia?


Si bien las mutaciones modifican la naturaleza de los genes al azar, existen otros procesos, también al azar, que tienen lugar durante la reproducción sexual que no modifican los genes sino que “juegan” con ellos, distribuyéndolos entre los organismos de una misma especie de manera diferente, aumentando la variabilidad en los seres vivos. Estos procesos son la reorganización cromosómica, la recombinación genética y la fecundación. Constituyen fuentes secundarias de variabilidad.

La reorganización cromosómica tiene lugar en la meiosis, por lo que puede ser interesante estudiar algunos aspectos generales de los procesos de división nuclear, tanto por mitosis como por meiosis:

La Mitosis: Consiste en la división del núcleo celular, por lo que posteriormente debe dividirse el resto de la célula para completar la división celular. Este proceso permite obtener 2 células idénticas a la original en lo referente al número de cromosomas. Se trata del mecanismo habitual de división y se utiliza para obtener células somáticas (“del soma o cuerpo”). Es necesaria para permitir el crecimiento (aumenta el número de células) y la reposición (sustituir células muertas). Dado que una célula tiene un número determinado de cromosomas y cada uno contiene una molécula de ADN, será necesario multiplicar por 2 el número de moléculas de ADN, como comprobamos esto determina que los cromosomas pasen a tener 2 cromátidas en vez de una, pues bien, durante la mitosis estos cromosomas dobles se separan a nivel del centrómero y vuelven a proporcionarnos cromosomas de una sola cromátida que son arrastrados por las fibras del huso acromático a los polos contrarios de la célula (una cromátida para cada lado) de manera que ya tenemos la situación de partida, solo falta que los 2 grupos de cromosomas se rodeen de una nueva envoltura nuclear y que el resto de la célula se divida, dándonos dos células con el mismo número de cromosomas que la célula original.

La Meiosis: Este mecanismo de división produce células reproductivas o gametos de forma que será el que más nos interese a la hora de estudiar las distintas fuentes de variabilidad.

En este caso se producirán 2 divisiones consecutivas. En la primera los cromosomas homólogos se sitúan a ambos lados del plano ecuatorial, emigrando un homólogo completo a cada polo de la célula, como consecuencia obtendremos 2 células con la mitad de los cromosomas de la célula original (división reduccional), la segunda división es equivalente a una mitosis, de forma que se separarán las cromátidas de cada cromosoma doble y emigraran a los polos contrarios como cromosomas sencillos o de una sola cromátida, en consecuencia obtendremos 4 células, estas, una vez maduras, darán lugar a 4 espermatozoides o gametos masculinos ó a un óvulo, o gameto femenino ya que las otras 3 células resultantes degeneran y mueren. Sin embargo estos gametos se caracterizan por presentar un número haploide de cromosomas o sea en nuestro caso 23 que resulta ser la mitad de los que presenta la célula de la que proceden. En estos cromosomas se encuentra toda la información necesaria ya que está representado siempre uno de los dos cromosomas homólogos o lo que es lo mismo, se trata de un “juego” completo de cromosomas. De esta manera cuando se fusionen dos gametos a través de la fecundación la célula resultante (zigoto) presentará 2 juegos completos, esto es, una dotación diploide igual a 46 cromosomas en el caso de la especie humana.

La división del núcleo se continúa con la división del resto de la célula o citocinesis.

LA MITOSIS









Recombinación








LA MEIOSIS


  1. Imagínate un organismo con 4 cromosomas (2 parejas). En el dibujo siguiente los

c
Cromosomas

homólogos
romosomas azules son los que ese organismo ha heredado de su padre y los rojos son los que ha heredado de su madre. Como puedes observar, al distribuirse estos cromosomas entre los gametos, los cromosomas de origen paterno o materno no tienen porque permanecer juntos sino que se distribuyen al azar. Para un organismo de 4 cromosomas el número posible de gametos distintos es 4.
Si se tratase de un organismo con 6 cromosomas (3 parejas), cada célula madre sigue originando 4 gametos en la meiosis, pero el número de gametos posibles es 8, ya que existen 8 formas posibles de combinar a los cromosomas. Dibuja cuáles serían estas combinaciones en cada uno de los posibles gametos.
Como habrás podido observar, los cromosomas que recibe un determinado gameto no tienen porqué incluir todos los heredados del padre o todos los heredados de la madre, sino que es una combinación de ambos. Se ha producido un proceso de reorganización cromosómica y, por tanto, de reorganización genética, cuya consecuencia es el aumento de variabilidad en una población, ya que se originan gametos con nuevas combinaciones de genes. El número de gametos diferentes es igual a 2n, siendo “n” el número haploide de cromosomas de una especie, el número haploide es igual al número de cromosomas de un juego cromosómico donde solo está representado uno de los 2 homólogos. En el ejemplo anterior n = 3, esto implica que el nº de gametos distintos es igual a 23 = 8.

Durante la meiosis los cromosomas semejantes u homólogos (llevan genes que informan para los mismos caracteres) se entrecruzan en diferentes puntos y se intercambian segmentos de cromosomas (varios genes) entre ellos. Este proceso se llama recombinación genética y origina gametos con nuevas combinaciones de genes, además de las ya originadas por el proceso de reorganización cromosómica.



Posteriormente, durante la fecundación, los genes de la madre y del padre, transportados por el óvulo y el espermatozoide, respectivamente, completarán la dotación diploide necesaria para que tenga lugar el desarrollo del embrión, al término del cual se originará un organismo con características diferentes a las del padre y de la madre y a las de sus posibles hermanos.

Resumiendo, podemos concluir que la variabilidad existente entre los individuos de una población se debe a las variaciones genéticas originadas por las mutaciones, que cambian la naturaleza de los genes, y a la reproducción sexual que por los procesos de reorganización cromosómica, recombinación genética y fecundación, produce nuevas combinaciones genéticas, aumentando así la variabilidad entre los organismos de la misma especie.

Fuentes de variabilidad





similar:

Selección natural iconSelección natural
«costo» de la selección natural,2, ySewall Wright, quién elucidó sobre la selección y la adaptación,3

Selección natural icon2. Desde la perspectiva que defiende la selección multinivel, la...

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural

Selección natural iconSelección natural




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com