Actividades de aplicacióN: adn cromosomas ciclo celular división celular




descargar 150.99 Kb.
títuloActividades de aplicacióN: adn cromosomas ciclo celular división celular
fecha de publicación22.01.2016
tamaño150.99 Kb.
tipoDocumentos
b.se-todo.com > Química > Documentos
ACTIVIDADES DE APLICACIÓN: ADN – CROMOSOMAS – CICLO CELULAR – DIVISIÓN CELULAR

1- Completa el siguiente texto utilizando las siguientes palabras: Ciclo copia cromátidas doble duplicación es la misma interfase

La información genética  en todas las células de un . Sin embargo, a lo largo del  celular la cantidad de ADN . Así, la cantidad de ADN es el  al final de la , ya que se produce una  de este material genético para que cada célula hija reciba una . Antes de ser repartidas estas copias de ADN a las células hijas pueden verse, unidas a proteínas, en forma de .

2- Ordena los siguientes bloques de palabras de manera que se forme un texto con sentido:

   El hecho de que el ADN sea una      se haya producido una mutación, es decir, un      MOLDE para crear otra. Las dos dobles cadenas hijas      de las cadenas originales sirve de      error en la duplicación, que da lugar a un      gen alterado.      importante, ya que cada una      serán idénticas, salvo que      doble cadena es muy 

3- Resuelve este crucigrama:

1   

 

 

 

 

 

2   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

3   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

4   

 

 

 

 

 

 

 

 

5   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6   

 

7   

 

 

 

8   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



Horizontales:

1.

Una de las moléculas que forma los nucleótidos. Se trata de un azúcar presente en el ADN.

3.

Molécula formada por la unión de un azúcar (la desoxirribosa), un ácido fosfórico y una base nitrogenada. La unión de muchas de ellas forma el ADN.

4.

Base nitrogenada complementaria de la Guanina.

5.

Base nitrogenada complementaria de la Adenina.

8.

Molécula con fósforo que forma parte de los nucleótidos que constituyen el ADN. Se trata del ácido .....




Verticales:

1.

El ADN no es una cadena simple, sino .....

2.

Nombre dado a la duplicación del ADN.

6.

Cuando se produce la Replicación, cada una de las cadenas originales sirve de ........... para crear otra.

7.

Ácido desoxirribonucleico.




4- Estudia atentamente el descubrimiento más importante de la Biología. Después completa el ejercicio.

Este es quizás el descubrimiento más importante del siglo XX y de toda la Historia de la Biología:

Utiliza estas palabras para resolver el ejercicio que sigue: Traducción transcripción ARN proteínas replicación

Es la fabricación de proteínas con la información del ARN y, por tanto, del ADN.

      




Son largas cadenas de aminoácidos. Hay 20 aminoácidos diferentes que se colocan siguiendo las instrucciones del material genético.

      




Es la copia de la información del ADN al ARN. Esta información será traducida para formar proteínas.

      




Es la duplicación del ADN. Ocurre antes de que la célula vaya a dividirse.

      




Es el ácido ribonucleico. Es una molécula parecida al ADN, que se forma gracias a la Transcripción.

      




5- Completa el siguiente texto utilizando estas palabras: Cadenas complementarias copias dobles idénticas interfase molde

El ADN es capaz de sacar  de sí mismo. Este proceso se denomina . En el ciclo celular, la replicación ocurre al final de la , antes de que la célula vaya a dividirse. Primero la doble cadena de ADN. Después se van añadiendo , con las bases nitrogenadas  a las de la doble cadena inicial. Cada una de las  originales ha servido de  para crear otra. Al final se obtienen dos  cadenas  entre sí y a la original.
En la replicación del ADN intervienen varias enzimas: helicasa, , ligasas...

6- Resuelve este ejercicio. Lee atentamente el texto de la derecha.

A T T T A C C G G C T A
T A A A T G C C C G A T 



A T T T A C C G G C T A
 



 
T A A A T G C C C G A T

7- Estudia con atención los dibujos y el texto antes de completar las dos actividades:



Químicamente, el ARN (ácido ribonucleico) se parece al ADN, pero es una molécula sencilla, y no doble como la del ADN. Además, la base Uracilo, parecida a la Timina, sustituye a ésta.
El ARN, cuando termina de formarse, se separa del gen (ADN) que le ha servido como molde. Después, el ARN abandona el núcleo celular para viajar hasta el citoplasma. Más adelante veremos cómo allí, el "mensaje" que lleva servirá para fabricar una proteína específica del gen.

Actividad 1 Escribe la secuencia de bases del ARN que se forma por la transcripción del gen representado en rojo de este ADN.
CGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
GCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Solución => El ARN transcrito es:  
Actividad 2 ¿Verdadero o falso?
- El ARN es más corto que el ADN:  
- El ARN es una cadena doble, como el ADN:  
- Las bases del ARN son: A, T, C, y G:  
- Las bases del ARN son: A, U, C, y G:  
- La formación de ARN se denomina Replicación:  
- Adenina y Uracilo son bases complementarias:  
- Adenina y Timina son bases complementarias: 

3- Estudia el texto y la ilustración. Después, responde a las preguntas:

Existen tres clases de ARN:
ARN mensajero (ARNm). Cada ARNm es una copia de la información de un gen, necesario para la síntesis o fabricación de una proteína.
ARN ribosómico (ARNr). Este tipo de ARN forma parte de la estructura de los ribosomas.
ARN transferente (ARNt). Lleva, hasta los ribosomas, los aminoácidos que van a unirse para formar una proteína.

  1. ¿Qué tipo de ARN tiene la información genética o el "mensaje" necesario para la síntesis de las proteínas?. Escribe su abreviatura (tres letras en mayúscula y la cuarta minúscula):

Principio del formulario

Final del formulario

  1. ¿Qué tipo de ARN lleva los aminoácidos hasta los ribosomas?. Escribe su abreviatura (tres letras en mayúscula y la cuarta minúscula):Principio del formulario

Final del formulario

  1. ¿Qué tipo de ARN forma parte de la estructura de los ribosomas?. Escribe su abreviatura (tres letras en mayúscula y la cuarta minúscula):



Principio del formulario

4. Señala las cuatro bases nitrogenadas del ARN:

1. Timina

2. Ácido fosfórico

3. Uracilo

4. Desoxirribosa

5. Ribosa

6. Citosina

7. Adenina

8. Melanina

9. Guanina

10. Ribonucleótido

5. Señala las cuatro bases nitrogenadas del ADN:

1. Adenina

2. Ribosa

3. Uracilo

4. Desoxirribonucleótido

5. Guanina

6. Ribonucleótido

7. Desoxirribosa

8. Ácido fosfórico

9. Timina

10. Citosina

6. Señala las características del ARN:

1. Se forma por Transcripción

2. El azúcar es la ribosa

3. Se forma por Replicación

4. Es más largo que el ADN

5. Es más corto que el ADN

6. Es una cadena simple

7. Es una doble cadena

8. Tiene Timina en lugar de Uracilo

9. El azúcar es la desoxirribosa

10. Tiene Uracilo en lugar de Timina

7. ¿Qué nombre recibe el proceso de duplicación del ADN?

1. Inversión o delección

2. Traducción

3. Transcripción

4. Replicación

5. Mutación

8. Marca las características de un ARNm

1. Sale al citoplasma hasta unirse con ribosomas

2. Es una cadena simple de ribonucleótidos

3. Transporta aminoácidos hasta los ribosomas

4. Lleva información para fabricar una proteína

5. Se forma por la transcripción de un gen

6. Forma parte de los ribosomas

7. Se forma por replicación del ADN

8. Nunca sale del núcleo celular

9. Se forma en el núcleo

10. Lleva el mensaje de un gen

9. ¿Qué nombre recibe el proceso de síntesis del ARN con la información del ADN?

1. Replicación

2. Translocación

3. Traducción

4. Transcripción

5. Mutación

10. ¿Qué son los pequeños pero numerosos ribosomas?

1. Orgánulos celulares encargados de la síntesis del ARNm

2. Lo mismo que el ARNr

3. Orgánulos celulares encargados de la síntesis del ADN

4. Orgánulos celulares encargados de la síntesis de proteína

11- Final del formulario

Intenta completar el texto. Este vídeo te será de gran ayuda. http://www.youtube.com/watch?v=FNqmh4PoMPQ

Aminoácido anticodón ARN ARNm ARNt bases codón

El  de transferencia, que lleva unido el , se dirige hacia el complejo formado por el ARNm y el ribosoma. El  del ARNt se empareja con el  presente en el . La secuencia de  del codón codifica para el aminoácido concreto que transporta el ARNt.
Un segundo  se une a este complejo. El primer ARNt transfiere su aminoácido al segundo ARNt antes de separarse del ribosoma. El segundo ARNt lleva ahora 2 aminoácidos unidos que constituyen el inicio de la cadena . Después el ribosoma mueve la cadena de ARNm de manera que el siguiente codón de ARNm está disponible para unirse a un nuevo ARN de . El ribosoma continúa desplazando la cadena de ARNm hasta que se termina de formar la proteína.

12- Observa el dibujo. Después, responde a las preguntas:

1.¿Dónde ocurre la Traducción o Síntesis de Proteínas?

A. En la mitosis y meiosis

B. Fuera del núcleo, en el citoplasma

C. Dentro del núcleo, en el nucleoplasma

2. ¿Qué representa la línea roja con letras?


A. El ARNr

B. El ARNm

C. El ARNt

3.¿Qué orgánulo se representa en este dibujo?

A. Un ribosoma, un orgánulo presente en todas las células: procariotas y eucariotas

B. Un lisosoma, un orgánulo exclusivo de las células procariotas.

C. Un ribosoma, un orgánulo exclusivo de las células eucariotas.
4. ¿De qué está hecho un ribosoma?

    1. De ARNr y otras sustancias

    2. De ARNt y otras sustancias

    3. De ARNm y otras sustancias


5. ¿Qué representa esto?

    1. El ADN

    2. El ARNt

    3. El ARNm

    4. El ARNr


6. ¿Qué señala la flecha roja?

    1. El codón del ARNt

    2. El anticodón del ARNm

    3. El anticodón del ARNt

    4. El codón del ARNm


7. ¿Qué señala esta otra flecha?

    1. Una proteína que es llevada por el ARNt hasta el ribosoma

    2. Un aminoácido que es llevado por el ARNt hasta el ribosoma

    3. El anticodón del ARNt


8. ¿Qué es esto?

    1. Un aminoácido formándose

    2. Una cadena polipeptídica, una proteína en formación

    3. Un ARNm formándose

9. ¿Cuántas bases del ARNm forman un codón?

    1. Dos

    2. Ninguna

    3. Cuatro

    4. Tres


10. ¿Cuántas bases del ARNt forman un anticodón?

    1. Dos

    2. Tres

    3. Cuatro

    4. Ninguna


11. ¿Cómo tienen que ser las bases del codón para emparejarse con las del correspondiente anticodón?

    1. Semiconservativas

    2. Antagónicas

    3. Antiparalelas

    4. ComplementariasPrincipio del formularioFinal del formulario


12. Observa el dibujo del código genético: ¿qué aminoácido corresponderá al codón GUC?

    1. El CAG

    2. El aa7 (aminoácido nº 7)

    3. No lo sé, no lo entiendo

    4. El aa5 (aminoácido nº 5)




 

Las tres letras del interior de la tabla del código genético indican las abreviaturas de los aminoácidos (excepto STOP, que significa fin de la síntesis de proteína). Completa el ejercicio mirando la tabla:

Actividad 20.1.- Escribe la secuencia de bases del ARN que se forma por la transcripción del gen representado en rojo de este ADN.
CGGCATTAATCCGATACCTAGTACCGCGGATGCAAACTTGGATC
GCCGTAATTAGGCTATGGATCATGGCGCCTACGTTTGAACCTAG
Solución => El ARN transcrito es:  
Actividad 20.2.- Escribe la secuencia de aminoácidos correspondiente al ARNm obtenido en la actividad 20.1- (*)
Solución => La cadena de aminoácidos es:  

(*) Escribir cada aminoácido con su abreviatura (primera letra mayúscula), con guión de separación (por ejemplo Ala-Cys-Ser-Val). No poner la palabra STOP (no se trata de ningún aminoácido).

Todos los seres vivos usamos el mismo código genético, por lo que se dice que este código es univeral. Esto se debe a que todos los seres vivos compartimos un único antepasado común, hace millones de años. El primer ser vivo "inventó" este código y, desde entonces, todos sus descendientes lo utilizamos.

Todos los seres vivos usamos el  código genético, por lo que se dice que este código es . Esto se debe a que todos los seres compartimos un único antepasado , hace millones de años. El  ser vivo "inventó" este  y, desde entonces, todos sus  lo utilizamos.

Actividades de aplicación: Biotecnología

Estudia los esquemas y completa los textos correspondientes:

La insulina es una hormona proteica constituida por 51 aminoácidos. La insulina es el primer caso de proteína producida por ingeniería genética aprobada para uso en humanos, desde 1982. En la actualidad, varios laboratorios farmacéuticos producen insulina humana, tanto a partir de bacterias como de levaduras, y sin ningún riesgo para la salud.

bacteria – Biotecnología – humano – hijas – insulina – modificadas – proteína – purificación – transmitiendo - universalidad

La  del código genético puede aprovecharse en nuestro beneficio gracias a la . Si, por ejemplo, introducimos un gen  en una , ésta fabricará la correspondiente  humana. Así es posible obtener  humana en gran cantidad y, por consiguiente, de forma relativamente barata, gracias a cultivos de bacterias  genéticamente. Estas células bacterianas modificadas se reproducen  el gen humano a las células . Tras la extracción y , la insulina está lista para los diabéticos.

aplicaciones – cambiar – clonación – consumo – ganaderas – genética – genes – implicaciones – organismo - regulación

La manipulación de los  es el objetivo de la ingeniería genética. Gracias a estas técnicas, en la actualidad se pueden eliminar, añadir o  los genes de una célula u . La manipulación de los genes tiene múltiples , desde la investigación hasta la biotecnología.
Con la biotecnología se obtienen muchos productos de  habitual y se desarrollan importantes aplicaciones biosanitarias, agrícolas y .
La  y la obtención de organismos transgénicos son dos procesos biotecnológicos basados en la ingeniería .
La manipulación de los genes tiene  éticas y sociales que hacen necesaria, mediante leyes, una  de su investigación y de su aplicación. 
Vídeo recomendado: Vida artificial >>>http://www.youtube.com/watch?v=UapO_-GxN20

http://recursos.cnice.mec.es/biosfera/alumno/4ESO/Genetica2/contenido4.htm



Actividad de aplicación: Completa el texto con estas palabras

 23    46    ADN    brazos    cariotipo    cromátidas    duplican    equitativa    genes    hereditaria    meiosis    

mitosis    núcleo    

Los cromosomas son los portadores de nuestros . A su vez, nuestros genes son los que transmiten la información  de padres a hijos.

El  se encuentra en el  de la célula, densamente compactado y unido a proteínas. Cuando la célula se va a dividir, los cromosomas se  para poder distribuir la información genética de forma  entre las dos células hijas.

Tras la duplicación, los cromosomas estarán formados por dos partes idénticas denominadas , unidas entre si por el centrómero, que divide a cada cromosoma en dos partes denominadas .

En la división celular llamada , las dos cromátidas de un mismo cromosoma se separan, yendo cada una a una céula hija.

En la especie humana existen  cromosomas, pero en los gametos humanos, óvulos y espermatozoides, sólo hay  cromosomas; al unirse los dos gametos en la fecundación, el cigoto volverá a tener los 46 cromosomas de la especie. La división por la cual se forman los gametos se denomina , y consiste en dos divisiones consecutivas de las céulas diploides del tejido germinal, una para separar los cromosomas homólogos, y otra para separar las cromátidas y originar los gametos haploides

El  es la representación de los cromosomas ordenados por pares de homólogos y por tamaños; de todos los cromosomas, existen dos que determinan el sexo, son los cromosomas X e Y.


Actividades de aplicación:
1. Completa estas frases usando las siguientes palabras: dos, cuatro, haploides (n), diploides (2n).
a) Las células de mi mano son ……………………

b) Los espermatozoides y los óvulos son células ……………………

c) Una célula 2n, al sufrir una mitosis, da lugar a …….. células hijas ……………………

d) Una célula 2n, al sufrir una meiosis, da lugar a ……… células hijas ……………………

e) Las células somáticas son ……………………
2. Contesta a las preguntas después de observar esta imagen, obtenida a partir de una célula humana de la mucosa bucal (un tejido epitelial que tapiza la cavidad bucal):

a) ¿Qué se muestra en esta imagen? ………………………………………………………

b) ¿Qué indican los números?..................................

………………………………………………………..

c) ¿Se trata de una célula haploide o diploide? ………………………………………………………

d) ¿Cuántas cromátidas tiene cada cromosoma? ………………………………………………………

e) ¿Se trata de un hombre o de una mujer? ……………………………………………………….
Actividades de aplicación:
1. Completa estas frases usando las siguientes palabras: dos, cuatro, haploides (n), diploides (2n).
a) Las células de mi mano son ……………………

b) Los espermatozoides y los óvulos son células ……………………

c) Una célula 2n, al sufrir una mitosis, da lugar a …….. células hijas ……………………

d) Una célula 2n, al sufrir una meiosis, da lugar a ……… células hijas ……………………

e) Las células somáticas son ……………………
2. Contesta a las preguntas después de observar esta imagen, obtenida a partir de una célula humana de la mucosa bucal (un tejido epitelial que tapiza la cavidad bucal):

a) ¿Qué se muestra en esta imagen? ………………………………………………………

b) ¿Qué indican los números?..................................

………………………………………………………..

c) ¿Se trata de una célula haploide o diploide? ………………………………………………………

d) ¿Cuántas cromátidas tiene cada cromosoma? ………………………………………………………

e) ¿Se trata de un hombre o de una mujer? ……………………………………………………….

similar:

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconTema 14 división celular el ciclo celular

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconCuerpo celular de la neurona está compuesto por núcleo, que contiene...

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconSon la punta de los cromosomas (que llevan la información genética...

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconPalabras clave: microscopio, célula, biología celular, teoría celular, modelo celular

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconResumen El zinc es un nutriente traza esencial y se interrelaciona...

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconDivision celular

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconCuestionario división celular

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconProceso de division celular

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconDivision celular meiosis-mitosis

Actividades de aplicacióN: adn cromosomas ciclo celular división celular iconUnidad 1: material genético y división celular




Todos los derechos reservados. Copyright © 2015
contactos
b.se-todo.com