Cuestionario n° 5




descargar 195.08 Kb.
títuloCuestionario n° 5
página4/5
fecha de publicación25.01.2016
tamaño195.08 Kb.
tipoCuestionario
b.se-todo.com > Química > Cuestionario
1   2   3   4   5

Cuestionario N° 8

Técnicas utilizadas en biología molecular


1) ¿Qué es necesario conocer antes de poder diseñar un protocolo basado en PCR para la detección de un gen determinado?

2) ¿Cómo se podría asegurar que los cebadores utilizados en un ensayo sólo hibridizarán con el ADN que se quiere detectar?

3) ¿Qué son y cómo funcionan los “terminadores de cadena” utilizados para secuenciar ADN?

4) ¿Qué terminadores de cadena se utilizan actualmente en el secuenciado de ADN y como drogas anti-AIDS?

5) ¿Cómo se puede diagnosticar una enfermedad causada por una inserción de material genético (fragmento de ADN) dentro de un gen?

6) ¿Qué es una enzima de restricción? ¿De dónde se obtienen? ¿Para qué se usan? ¿Qué tipos de extremos pueden dejar en el DNA de cadena doble?

7) ¿De qué manera se protege el ADN de la bacteria de la acción de sus propias enzimas de restricción?

8) ¿Qué es un plásmido? ¿Qué características debe reunir para funcionar como vector? Esquematizalo ¿A qué se llama plásmido recombinante? ¿Cómo se logra?

9) Al hacer ADN recombinante, ¿Cuál es el beneficio de usar una enzima de restricción que corte el ADN dejando extremos pegajosos?

10) Dadas las siguientes moléculas de ácidos nucleicos de cadena doble:

    1. AAGTTCTCTGAA b) GTCGTCAATGCA c) GGACCTCTCAGG

TTCAAGAGACTT CAGCAGTTACGT CCTGGAGAGTCC

Señale V o F:

  1. Ninguna de las tres moléculas puede ser degradada por una RNasa.

  2. Las tres moléculas tienen igual temperatura de fusión (Tm) porque tienen la misma longitud.

  3. Las tres tienen igual Tm porque [T]/[A] = 1 y [G]/[C] = 1 (Reglas de Chargraff).

  4. Las dos hebras de cada una de ellas son antiparalelas.

  5. Tm a >Tm b > Tm c

  6. Tm b > Tm a > Tm c

  7. Tm c > Tm b > Tm a

  8. Tm a > Tm c > Tm b

Justifique

11) Coloca según corresponda(N=Northern; S= Southern; W=Western o X= Ninguna) a qué técnica de hibridación corresponde cada una de las siguientes afirmaciones





La detección de fragmentos de ARN sobre una membrana usando anticuerpos específicos radioactivos




La detección de fragmentos de ARN sobre una membrana usando una sonda de ADN radioactivo




La detección de proteínas sobre una membrana usando anticuerpos específicos marcados




La detección de de fragmentos de ADN sobre una membrana usando anticuerpos específicos radioactivos




La detección de de fragmentos de ADN sobre una membrana usando una sonda de ADN radioactivos




12) Cuál de las siguientes enzimas de restricción que se detallan a continuación podrían escindir el segmento de ADNc que codifica el péptido KIGPACF?

Enzima de restricción Secuencia de reconocimiento

  • Alu 1 AGCT

  • Sau 96I GGN*CC

  • Hind III AAGCTT

* cualquier nucleótido
13) Las enzimas de restricción BamHI y PstI reconocen ciertas secuencias de ADN y producen cortes como se ilustran a continuación:
PstI

5`--- C T G C A G---3` --- C T G C A G---

3`--- G A C G T C---5` --- G A C G T C---


BamHI



5`--- G G A T C C---3` --- G G A T C C---

3`--- C C T A G G---5` --- C C T A G G---




  1. Indicar los extremos 5`y 3`de las moléculas de ADN escindidas

  2. ¿Cómo se podrían modificar los extremos de las moléculas cortadas si se las incubara con ADNpol en presencia de todos los dNTPs?

14) En un experimento se usaron bacterias E. coli a las cuales se le introdujo el gen de una proteína de algas que emite fluorescencia verde, llamada green fluorescent protein (GFP). Este gen había sido modificado previamente in vitro de la siguiente manera: su ADN estaba formado por una hebra con secuencia normal (wild-type) acompañada de su hebra complementaria que tenía una mutación, de modo de crear un apareamiento erróneo o missmatch en uno de de sus pares de bases, es decir que no cumple con las reglas de Watson y Crick. (Tal missmatch en la doble hélice resultó ser estable en estas bacterias porque estas tenían mutaciones en algunos de sus genes, que les impedía hacer la habitual reparación de missmatches). Luego de la modificación genética mencionada, las bacterias fueron sembradas en un caja de Petri con medio de cultivo sólido e incubadas a 37°C. ¿Qué tipo de colonias esperaría Ud. ver al día siguiente?

  • Colonias blancas

  • Colonias verdes

  • Colonias mixtas

15) Ud. ha clonado un fragmento BamHI de 3Kb conteniendo el gen que quiere secuenciar. Quiere realizar un mapa de restricción del fragmento clivándolo en subfragmentos menores y determinar su orden relativo. Para eso digiere 3 muestras separadas del fragmento purificado con EcoRl, Hpall y una mezcla de las dos enzimas.

Los digestos los somete a una electroforesis en gel de agarosa y los revela con bromuro de etidio para visualizar el patrón de bandas. De acuerdo a los resultados obtenidos diagrame un mapa de restricción y exprese las distancias en Kb.


1,6 Kb

1,4 Kb


EcoRl EcoRl + Hpall Hpall


1,7 Kb

0,9 Kb

0,4 Kb



1,2 Kb
0,9 Kb
0,5 Kb

0,4 Kb




16) Se ha cortado con la enzima de restricción BglII un plásmido bacteriano circular que contiene un gen de resistencia a tetraciclina. Tras la electroforesis, se observa una única banda de 14 kb. a-¿Qué deduciría de este resultado?

Ese plásmido cortado con EcoRV produce dos bandas de 2,5 y 11,5 kb. b- ¿Qué puede deducir de este resultado?

La digestión con las dos enzimas a la vez produce tres bandas, de 2,5; 5,5 y 6,0 kb. c-¿Qué indica este resultado?

El DNA del plásmido cortado con BglII se mezcló y ligó con fragmentos de DNA donante también cortado con BglII, para generar moléculas recombinantes. Todos los clones recombinantes resultaron ser resistentes a tetraciclina. d- ¿Qué deduciría de este resultado?

e. Tras cortar un clon recombinante con BglII, se observan dos fragmentos, de 4 y 14 kb. Explique este resultado.

f. Explique el conjunto de resultados mostrando un mapa de restricción del DNA recombinante.
17) Un ejemplo de plásmido de clonación idóneo es el pBR322 que se replica en E. coli. Este plásmido tiene varias características que le hacen adecuado como vector de clonación, entre ellas podemos mencionar: su pequeño tamaño y el conocimiento de su secuencia completa, presenta sitios únicos de corte para varias enzimas de restricción (PstI, SalI, EcoRI, HindIII y BamHI), además posee un gen responsable de resistencia a la tetraciclina y otro que le confiere resistencia a la ampicilina. El sitio para BamHI está dentro del gen de resistencia a la tetraciclina, mientras que el sitio para PstI está dentro del gen de resistencia a la ampicilina.

Cultivos de E. coli que contienen el plásmido pBR322 fueron tratados con las enzimas BamHI y PstI y luego cultivados en distintas placas de agar conteniendo ambos antibióticos (tetraciclina + ampicilina), sólo ampicilina, solo tetraciclina o ninguno de ellos. En algunos casos se sabe que luego de la digestión enzimática y linearización se ha producido la recircularización del plásmido sin que se haya introducido ningún otro fragmento de ADN.

Según los datos que se muestran en la siguiente tabla, ¿podría indicar que tipos de tratamientos recibieron cada cultivo?



Muestras

Crecimiento de E. coli en:

Amp+Tet

Amp

Tet

Sin ATB

A

++

++

++

+++

B

+

++

--

+++

C

+

-

++

+++

D

-

-

-

+++

E*

-

+

+

+++

*¿Puede ser cierto este resultado? Explique.

18) Un científico distraído guardó los primers sin rotular de una bacteria pero no sabe cuál es el foward y el reverse. Sólo cuenta con las secuencias de cada uno que se indican a continuación:

AAGAAAAAGAAGTAGACCAAC

AAACGGCAAGACAAGTAAATA

Al estudiar las secuencias en la base de datos (BLASTn) encuentra los siguientes resultados:
Primera secuencia analizada

Accession

Description

Query coverage*

Max ident

X17214.1

S. faecalis plasmid pAD1 asa1 gene for aggregation substance and ORF 1

100%

100%

AE016831.1

Enterococcus faecalis V583 plasmid pTEF2, complete sequence

100%

100%

AE016833.1

Enterococcus faecalis V583 plasmid pTEF1, complete sequence

100%

100%

AE016830.1

Enterococcus faecalis V583, complete genome

100%

100%

U91527.1

Enterococcus faecium plasmid pHKK701 aggregation substance (ash701) gene, complete cds

100%

100%

* Analizó las 21 letras de la secuencia

Segunda secuencia analizada


Accession

Description

Query coverage

Max ident

AL807827.11

Zebrafish DNA sequence from clone CH211-220J6, complete sequence

80%

100%

AC102164.7

Mus musculus chromosome 3, clone RP23-438M14, complete sequence

80%

100%

AC190269.3

Callithrix jacchus BAC clone CH259-1H12 from chromosome unknown, complete sequence

76%

100%

AC145321.3

Oryza sativa Japonica Group chromosome 11 clone OSJNBa0094P07, complete sequence

76%

100%

AC079356.2

Oryza sativa Japonica Group chromosome 5 clone P0016H04, complete sequence

76%

100%

XM_676666.1

Aspergillus nidulans FGSC A4 hypothetical protein (AN8489.2), mRNA

76%

100%

AC126444.3

Mus musculus BAC clone RP24-136A8 from chromosome 14, complete sequence

76%

100%


a- Analice los resultados obtenidos
19) Suponga que Ud. desea amplificar por PCR el fragmento escrito en mayúsculas en la siguiente secuencia de DNA:
`5−TAACCTGCAACCCTTTTCGGTATTGCTGATGAATCGAT……480NT….GAAGTCCGATTCGATGTGATGGGCATACCT ATGGCCATGG-3’

a. Escriba la secuencia de dos posibles oligonucleótidos (aprox. 18 a 24 pb cada uno) que le permitan amplificar el fragmento del problema.

b. Indique los componentes necesarios para la mezcla de reacción y diga en qué consisten los ciclos de amplificación, aclarando qué ocurre en cada etapa.

c. Explique cómo evalúa la obtención del producto de la reacción y como procedería para purificarlo y clonarlo.

d. ¿Cómo verificaría que obtuvo el producto esperado?
1   2   3   4   5

similar:

Cuestionario n° 5 iconCuestionario

Cuestionario n° 5 iconCuestionario

Cuestionario n° 5 iconCuestionario de u-5

Cuestionario n° 5 iconCuestionario so 02 08

Cuestionario n° 5 iconCuestionario a desarrollar

Cuestionario n° 5 iconCuestionario de Ecología

Cuestionario n° 5 iconCuestionario Capitulo 3

Cuestionario n° 5 iconCuestionario de Habilidades

Cuestionario n° 5 iconCuestionario de mutaciones

Cuestionario n° 5 iconCuestionario tutoria no: 1




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com