C dirección de elongación de la cadena




descargar 13.96 Kb.
títuloC dirección de elongación de la cadena
fecha de publicación06.02.2016
tamaño13.96 Kb.
tipoDirección
b.se-todo.com > Química > Dirección
EJERCICIOS
1.- Escribir la secuencia complementaria en dirección 5’ 3’

a) 5’- GATCAA- 3’

b) 3’- ACTGGCCTAA -5’

c) 5’- ACCTAGGGTA -5’

d) 3’- CCTGGATTAAG -5’
2.- Compare la ADN polimerasa I y la ARN polimerasa de E.coli en cuanto a:

a) estructura de subunidades.

b) precursores activados

c) dirección de elongación de la cadena

d) actividad exonucleasae) conservación del ADN molde

f) necesidad de una hebra particular.

d) energética de la reacción de elongación
3.- Escribir las secuencias de los mARN sintetizados de los siguientes ADNs

a) 3’- ATTGCCATGCTA-5’

b) 5’- AGCTACTTAACG-3’

c) 3’-GGACCTACGTT.5’

Además indique cuales son los codones sin sentido presentes.
4.- Cuantos aminoácidos pueden ser codificados de las siguiente secuencia de mARN.

a) Asumiendo que comienza la lectura en el extremo 5’ inmediatamente.

b) Comenzando en forma normal establecida por el código genético.

. 1- 5’- UUGCCUAUGGAUUGGAUG-3´

. 2- 3’-AUGUAGGUAAAGGUAGGCC-5’

. 3- 3’- AGCGCCAGUGACCAUGUA-5’
5.- Que secuencia es formado por la adición de un poli (UUAC) a un sistema de síntesis de proteínas.
6.- Señale los errores del siguiente texto: «...eI ADN es el ácido nucleico más abundante en la célula. Se encuentra, exclusivamente, en el núcleo celular y posee una masa molecular muy elevada. Químicamente, está formado por dos cadenas de polinucleótidos...».
7.-Indique a qué tipo de ácido nucleico corresponden las siguientes secuencias de bases nitrogenadas:

a) 5'.. .CCGATC. .3'.

b) 3'.. .GGATCC. .5'.

c) 3'... UACCGA. .5'.

d) 5'.. .ACCGGC.. .3'.
8.-¿Cuántos enlaces éster hay en un dinucleótido? ¿Dónde se localizan?. Representa el dinucleótido de A y T, unido a su complementario de un ARN.
9.-Escribe la secuencia de ARN resultado de la transcripción del siguiente fragmento de ADN

5´...ACGTACAGC..3´
10.-¿Qué Polipéptido es codificado por el siguiente trozo de ADN?: 3´...CTTCGTCAAATG...5´
11-¿Cuántas secuencias diferentes de ADN llevan información para la síntesis del polipéptido H2N-Gly-Cys-Gly-Ala-Ser-COOH?.
12-En qué tripletes de ARNm, de los que codifican la Gly, es más probable que la sustitución al azar de una sola base: a)Codifique la Ser.                        b)Sea un codón sin sentido.                      c)Codifique la Met.
13.-Supongamos la hebra de ADN: 3'...AATACAAAT...5'. Durante la transcripción de la misma hay un error de tal manera que frente al nucleótido de C se sitúa otro de citosina (en lugar de uno de guanina). ¿Se modificará la secuencia peptídica codificada por esa hebra de ADN?
14.-Relacione los nombres de la columna de la izquierda con la terminología de la columna de la derecha.

1) Virus     A)Nucleótido.
2) ARNr     B)Base púrica.
3) AMP     C)El ARN más abundante en las células.
4) Guanina.  D)ARN de vida muy corta.
5) ARNm.     E)Contienen ADN o ARN.
15.-Una molécula de ADN posee un 60 % de nucleótidos de T y A. Indique el porcentaje de cada uno de los nucleótidos que forman parte de dicho ADN.

.-¿Qué secuencia de ADN es la complementaria de 3'...TTCATTTAC...5'?
16.-ANALIZA las siguiente situaciones.. y contesta

A) “Tanto en procariontes como en eucariontes es posible obtener diferentes polipéptidos a partir de un mismo RNAm"

B “en eucariontes no es posible acoplar los procesos de transcripción con traducción”

17.-Completa oraciones

A- La replicación y la transcripción ocurren con la polaridad ........................ (5' a 3'; 3' a 5'). La replicación es un proceso ................. (simétrico; asimétrico) porque ambas hebras del DNA se replican.  La enzima DNA pol I participa en ............................. (replicación; transcripción). También es una enzima autocorrectora, puesto que además de la actividad catalítica de polimerasa posee la actividad de exonucleasa de   ..................(5' a 3'; 3' a 5').

B- En la replicación del DNA la hebra templado que posee la polaridad 5’ en la base de la horquilla y 3’ en el punto de bifurcación se llama hebra ........................... (conductora; retardada), por lo que el proceso de replicación de esta hebra es .................... (continuo; discontinuo). La enzima que inicia la replicación es la ................................(DNA pol.I; DNA pol.III),  que actúa en la forma de ........................  (holoenzima; primosoma).
El complejo formado entre la primasa y las proteínas auxiliares recibe el nombre de PRIMOSOMA
C- Usted tiene el siguiente RNAm:

5’-UCGGCUAUGGGGCUCUGCCGAAGUAGACGAGGGCGAUGGCGAAGACGAUAACCCGCCUAG –3’

Esta hebra de RNA se obtuvo por ............................ (transcripción; replicación) de la hebra ...................... (codificadora; templado) del DNA, con la cual su secuencia es complementaria. En cambio la secuencia del RNAm es idéntica a la hebra .....................  (codificadora; templado) del DNA.

similar:

C dirección de elongación de la cadena iconAlargamiento o elongación de las células

C dirección de elongación de la cadena iconLa transcripción en procariotas y eucariotas: iniciación, elongación,...

C dirección de elongación de la cadena iconEstefanía Cadena

C dirección de elongación de la cadena iconReacció n en cadena de la polimerasa

C dirección de elongación de la cadena iconCadena de custodia en aserrado

C dirección de elongación de la cadena iconPcr (Reaccion en Cadena de la Polimerasa)

C dirección de elongación de la cadena iconInforme sobre la Cadena Productiva de

C dirección de elongación de la cadena iconResumen: reacción en cadena de la polimerasa

C dirección de elongación de la cadena iconInforme sobre la Cadena Productiva de

C dirección de elongación de la cadena iconInforme sobre la Cadena Productiva de




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com