Paula Salinas




descargar 28.87 Kb.
títuloPaula Salinas
fecha de publicación02.08.2016
tamaño28.87 Kb.
tipoAula
b.se-todo.com > Biología > Aula

Transcriptional control of glutaredoxin GRXC9 expression by a salicylic acid-dependent and NPR1-independent pathway in Arabidopsis


Plant Molecular Biology Reporter



Ariel Herrera-Vásquez1, Loreto Carvallo1, Francisca Blanco1,, Mariola Tobar1, Eva Villarroel-Candia1, Jesús Vicente-Carbajosa2, Paula Salinas1 and Loreto Holuigue1,*.

1Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Alameda 340, Santiago, Chile

2Centro de Biotecnología y Genómica de Plantas (UPM-INIA), Universidad Politécnica de Madrid, 28223 Pozuelo de Alarcón, Madrid, Spain

*Corresponding Author: lholuigue@bio.puc.cl

Online Resource 8. Primers used for cloning genetic constructs, ChIP and RT-qPCR assays.




Target sequence

Forward Primer

Reverse Primer

Cloning GRXC9 promoter-GUS constructs




pC9 Wt

5’ CACCAAAACGCATCACCTGC 3’

5’ TTTCAAGTATGTTTTTAAAGATAG 3’




pC9 -168

5’ CACCGACACGGTCCTATG 3’

5’ TTTCAAGTATGTTTTTAAAGATAG 3’




pC9 -112

5’ CACCCCATAGCTTCCTGTG 3’

5’ TTTCAAGTATGTTTTTAAAGATAG 3’




pC9 -61

5’ CACCTTTCCTCTCTGATCTC 3’

5’ TTTCAAGTATGTTTTTAAAGATAG 3’

Cloning GRXC9 CDS




OX GRXC9


5’ CACCATGCCAAGGAACGATTTC 3’

5’ CAACCACAGAGCCCCAACTTCCT 3’

Site directed CRXC9 promoter mutations




pC9 MD

5’ TCCAATCCAGTTTTGTAAATAGC ACTATCACCCATAGCTTC 3’


5’ GAAGCTATGGGTGATAGTGCTATTTAC AAAACTGGATTGGA 3’




pC9 MP

5’ ATAGCTTCCTGTGTTTCACATCCTT ATTTAACCATCGTTGACG 3’


5’ CGTCAACGATGGTTAAATAAGGATGTGA AACACAGGAAGCTAT 3’


ChIP assays




GRXC9 proximal promoter -212 to +78

5´ GTGGGATCCAAAAAGTCAGC 3´

5´ CGACGGTTGTCGTCATGTTA 3´

RT-qPCR




Total GRXC9

(At1g28480)


5’ CACTCCAAGTCCAAGAAGCAG 3’

5’ AGAGAGTTCGGATGGTGGTG 3’




Endogenous GRXC9

(At1g28480)

5´ TTAAGGAAGTTGGGGCTCTG 3´

5’ CCGTAAACAACAATTACCAATCA 3´




PR-1

(At2g14610)

5’ GTGGGTTAGCGAGAAGGCTA 3’

5’ ACTTTGGCACATCCGAGTCT 3’





CLATHRIN ADAPTOR COMPLEX (At5g46630)

5’ AATACGCGCTGAGTTCCCTT 3’

5’ AGCACCGGGTTCTAACTCAA 3’




YLS8

(At5g08290)

5´ TTACTGTTTCGGTTGTTCTCCATTT 3’

5´ CACTGAATCATGTTCGAAGCAAGT 3’

similar:

Paula Salinas iconPaula Fernández Z

Paula Salinas iconPaula Sibilia

Paula Salinas iconPaula Carvacho

Paula Salinas iconPaula Belmar R

Paula Salinas iconPaula Satizábal P

Paula Salinas iconPaula Rojo

Paula Salinas iconPaula Álvarez Fernaud

Paula Salinas iconPaula Mathiasen and Andrea C. Premoli

Paula Salinas iconAna Aguilar y Paula Parrado

Paula Salinas iconTradução de ana paula cunha




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com