Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic




descargar 46.55 Kb.
títuloSafety assessment, genetic relatedness and bacteriocin activity of potential probiotic
fecha de publicación04.08.2016
tamaño46.55 Kb.
tipoDocumentos
b.se-todo.com > Biología > Documentos
European Food Research and Technology

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic Lactococcus lactis strains from rainbow trout (Oncorhynchus mykiss, Walbaum) and rearing environment
Carlos Araújoa-e, Estefanía Muñoz-Atienzaa, Martha Ramíreza, Patrícia Poetab-c, Gilberto Igrejasd-e, Pablo E. Hernándeza, Carmen Herranza and Luis M. Cintasa*
a Grupo de Seguridad y Calidad de los Alimentos por Bacterias Lácticas, Bacteriocinas y Probióticos (Grupo SEGABALBP), Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria, Universidad Complutense de Madrid, 28040-Madrid, Spain

b Centre for Animal Science and Veterinary, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal

c Veterinary Science Department, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal

d Institute for Biotechnology and Bioengineering, Centre of Genetics and Biotechnology, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal

e Department of Genetics and Biotechnology, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal
* Corresponding author. Phone: +34913943751. Fax: +34913943743. E-mail address: lcintas@vet.ucm.es (L.M. Cintas).
Online Resource 1
Table S1 Oligonucleotide primers used in this study
Table S1 Oligonucleotide primers used in this study


Target gene

Primer

5’–3’ sequencea

PCR fragment size (bp)

Annealing temperature (°C)

Reference

aad(E)

aadEI

GCAGAACAGGATGAACGTATTCG

369

55

[83]

aadEII

ATCAGTCGGAACTATGTCCC

aph(3′)-IIIa

aph(3')-F

GCCGATGTGGATTGCGAAAA

292

60

[87]

aph(3')-R

GCTTGATCCCCAGTAAGTCA

lin(A)

linA

GGTGGCTGGGGGGTAGATGTATTAACTGG

323

57

[85]

linA'

GCTTCTTTTGAAATACATGGTATTTTTCGATC

lin(B)

LINB1

CCTACCTATTGTTTGTGGAA

925

54

[80]

LINB2

ATAACGTTACTCTCCTATTC

tetB(P)

TetB/P-FW

AAAACTTATTATATTATAGTG

169

46

[83]

TetB/P-RV

TGGAGTATCAATAATATTCAC

tet(K)

tetKI

CAATACCTACGATATCTA

352

50

[83]

tetKII

TTGAGCTGTCTTGGTTCA

tet(L)

tetLI

TGGTCCTATCTTCTACTCATTC

385

53

[83]

tetLII

TTCCGATTTCGGCAGTAC

tet(M)

tetMI

GGTGAACATCATAGACACGC

401

45

[83]

tetMII

CTTGTTCGAGTTCCAATGC

tet(O)

tetOI

AGCGTCAAAGGGGAATCACTATCC

1,723

55

[83]

tetOII

CGGCGGGGTTGGCAAATA

tet(Q)

TetQ-FW

AGAATCTGCTGTTTGCCAGTG

169

63

[83]

TetQ-RV

CGGAGTGTCAATGATATTGCA

tet(S)

tetS-FW

ATCAAGATATTAAGGAC

573

55

[83]

tetS-RV

TTCTCTATGTGGTAATC

tet(T)

TetT-FW

AAGGTTTATTATATAAAAGTG

169

46

[83]

TetT-RV

AGGTGTATCTATGATATTTAC

tet(W)

tetWI

GGMCAYRTGGATTTYWTIGC

1,187

64

[83]

tetWII

TCIGMIGGIGTRCTIRCIGGRC

van(A)

vanA-36F

TTGCTCAGAGGAGCATGACG

957

65

[9]

vanA-992R

TCGGGAAGTGCAATACCTGC

van(B)

vanB-23F

TTATCTTCGGCGGTTGCTCG

994

62

[9]

vanB-1016R

GCCAATGTAATCAGGCTGTC

hdc

CL1

CCWGGWAAWATWGGWAATGGWTA

500

48

[84]

JV17HC

AGACCATACACCATAACCTT

ldc

CAD2-F

CAYRTNCCNGGNCAYAA

1,185

53

[82]

CAS2-R

GGDATNCCNGGNGGRTA

odc

3

GTNTTYAAYGCNGAYAARACNTAYTTYGT

1,446

52

[86]

16

TACRCARAATACTCCNGGNGGRTANGG

tdc

TD5

CAAATGGAAGAAGAAGTAGG

1,100

48

[81]

TD2

ACATAGTCAACCATRTTGAA

ERIC-PCR

ERIC-1R

ATGTAAGCTCCTGGGGATTCAC

variable

46

[33]

ERIC-2

AAGTAAGTGACTGGGGTGAGCG

rep-PCR

(GTG)5

GTGGTGGTGGTGGTG

variable

40

[36]

a K=G or T; R=A or G; W=A or T; Y=C or T; S=C or G; M=A or C; D=A, G, or T; N=A, G, C, or T

similar:

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconA global assessment of freshwater fish introductions in mediterranean-climate regions

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconGeneral Description Facilitated activity

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconProfessional scientific and teaching activity

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconShopping in the genetic supermarket

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconSupplementary indormation on populations analysed for both rdna and...

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconSupplementary indormation on populations analysed for both rdna and...

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconEQ: What factors lead to genetic variation in a population of organisms?

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconWhy Patenting Life is a Controversial Economical Activity. European...

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic iconSome basic ideas about genetic engineering and some related ethical and social concerns

Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic icon‘Genetic and phenotypic divergence in an island bird: isolation by...




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com