Transcripción, traducción, mutaciones




descargar 35.52 Kb.
títuloTranscripción, traducción, mutaciones
fecha de publicación03.08.2016
tamaño35.52 Kb.
tipoTranscripción
b.se-todo.com > Química > Transcripción
Temas 14 y 15. Genética Molecular (Transcripción, traducción, mutaciones)
EJERCICIOS PAU (Castilla y León)
Fuente: http://www.usal.es/webusal/node/28881?bcp=acceso_grados
Preguntas anteriores a 2010 ¿??
1. Si la hebra codificante de un oligonucleótido de DNA es la siguiente:

5’ – ATTAGCCGAATGATT – 3’

  1. Escriba la secuencia de la hebra molde del DNA.

  2. Escriba la secuencia del mRNA.

  3. ¿Cuántos aminoácidos codifica dicha hebra?

  4. Si AUG codifica Met; CGA Arg; AGC Ser; AUU Ile y UGA stop (finalización), escriba la secuencia del oligopéptido codificado por dicha hebra.

  5. Si se produce una mutación por delección del 10º nucleótido, ¿cuál sería la secuencia del oligopéptido formado?


2. Dadas las secuencias de polinucleótidos siguientes:

I) 5´- AGGCTACCTAAG – 3’

II) 5´- AGCGAUCAUGACA – 3’

III) 5´- CACCGACAAACGAA – 3’

  1. Indique razonadamente, en cada caso, si se trata de ADN ó ARN (1)

  2. ¿Son iguales las dos cadenas que componen la doble hélice del ADN? Razone la respuesta (3)

  3. Dado el siguiente fragmento de ADN 5´- CGATATAGCCGTTAA - 3´, escriba cuál será su ARN mensajero y la secuencia peptídica sintetizada a partir de él, señalando con claridad cual será el extremo N- y C-terminal del péptido producido (6)

(se incluye el código genético en hoja aparte)
3. La siguiente secuencia de una monohebra de ADN corresponde al inicio de un gen bacteriano:

5’- ATGTTAAGGGCCCGTTGTGTG – 3’

3’- TACAATTCCCGGGCAACACAC – 5’

a) Escriba la secuencia del ARNm correspondiente, indicando su polaridad. (2)

b) ¿Cuántos aminoácidos puede codificar este fragmento? (2)

c) ¿Qué características del código genético hay que aplicar para calcular el número de aminoácidos?

d) ¿Qué tipo de variación/es debería suceder en este fragmento de ADN para que produjera un polipéptido de 5 aminoácidos? Razone la respuesta. (3)
4.- a) Explique el concepto de transcripción. (3)

b) ¿En qué consiste la traducción del mensaje genético? (3)

c) Explique el papel de los ácidos ribonucleicos en el proceso de la traducción

5.- Observe el siguiente esquema:
2 4

ADN ARN PROTEÍNA




1 3
a) ¿Cómo se denomina cada una de las etapas numeradas en el mismo? (3)

b) Indique dos diferencias entre los ARN mensajeros de eucariotas y procariotas (3)

c) ¿Qué es un intrón? (2)

  1. ¿Qué es un codón? (2)


6. Indique si las afirmaciones siguientes son ciertas o falsas, razonando la respuesta:

a) Si se introduce en el ARNm formado durante la transcripción de un gen estructural un uracilo en la posición donde debería colocarse una citosina se produce una mutación.

b) Tanto en procariotas como en eucariotas, el ARNm puede ser traducido nada más sintetizarse.

c) En el ADN las dos hebras se replican por mecanismos diferentes.

d) Si dos genes estructurales tienen diferentes secuencias de tripletes podremos afirmar que codificarán diferentes cadenas peptídicas.
7. Con respecto al flujo de la información genética desde los cromosomas hasta las proteínas:

a) Nombre secuencialmente y por orden las biomoléculas por las que pasa la información genética. (3)

b) Mencione las estructuras celulares que intervienen en esa ruta. (3)

c) Si comparamos una célula hepática con una célula renal del mismo individuo: ¿contendrá su ADN la misma información? Y las proteínas de ambas células ¿serán las mismas? Razone las respuestas. (4)
8.- La siguiente secuencia polinucleotídica corresponde a un fragmento de inicio de un gen bacteriano:

5’ ATGCGAGGGCCCTGCGTGCTG 3’

3´ TACGCTCCCGGGACGCACGAC 5´

a) Escriba la secuencia de bases del ARNm que se pueda transcribir a partir de dicho fragmento (5) y señale su polaridad (1).

b) Indique el número máximo de aminoácidos que puede codificar el ARNm transcrito (2) y el criterio en que se basa para dar su respuesta (2).
9.- El esquema adjunto muestra el proceso por el que la información contenida en la secuencia de ADN se usa para sintetizar una proteína en una célula eucariota.
5´-ATTCGATGCGTCCTT-3´ ADN

3´-TAAGCTACGCAGGAA-5´

1)

5´-AUUCGAUGCGUCCUU-3´ ARN

2)

Ile-Arg-Cys-Val-Leu Proteína
b) ¿Cómo se denominan cada uno de los pasos 1) y 2) indicados con flechas en el esquema? ¿En qué compartimento celular se llevan a cabo cada uno de ellos? (4)

c) A partir del esquema deducir qué codones corresponden a cada uno de los aminoácidos.(

d) Una mutación puntual provoca que la primera base del ARN mensajero pase a ser una C en vez de una A. ¿Qué cambio puede originar esto en la secuencia de la proteína?
10.- En la replicación del ADN

a) Explique qué significa que la replicación es semiconservativa. (2)

b) ¿Qué significa que la replicación del ADN es bidireccional? (2)

c) Explique las semejanzas y diferencias en la síntesis de las dos hebras de ADN en una horquilla de replicación.
2006
4. Explica brevemente los aspectos estructurales del modelo de Watson y Crick de la molécula de ADN. ¿Cómo se encuentra codificada la información genética?
Junio 2010
General (Propuesta 5/2010)

4.- Indique las moléculas y estructuras subcelulares, necesarias para que se inicie la traducción (síntesis de proteínas) en procariotas en el citosol de una célula.
Específica (Propuesta 6/2010)

4.- El esquema adjunto corresponde a un importante proceso biológico:

a) ¿Qué proceso representa? ¿En qué fase del ciclo celular se produce?

b) ¿Qué finalidad tiene este proceso?

c) 2 y 3 son las cadenas de nueva síntesis, indique la denominación de cada una de ellas.

d) ¿Qué representan 1, 4 y 5?

e) ¿Por qué tiene que producirse la estructura marcada como 4?


Septiembre 2010
General (Propuesta 4/2010)

4.- Respecto a la expresión génica:

a) El proceso de traducción se realiza siguiendo diferentes etapas. Describa los elementos que participan en la etapa de iniciación y cómo se realiza. (8).

b) ¿Cuál es la enzima responsable de que se inicie el proceso de transcripción? (2)
Específica (Propuesta 3/2010)

4.- Un fragmento de ADN presenta la siguiente secuencia de bases:

5’… TTCGTTACACCCGCCTCTGGTGCA…3’

3´… AAGCAATGTGGGCGGAGACCACGT… 5´

Utilizando como molde la hebra correspondiente, tras su expresión da lugar a un fragmento de proteína con la siguiente secuencia de aminoácidos:

…Phe-Val-Thr-Pro-Ala-Ser-Gly-Ala…

a) ¿Cuál sería el fragmento correspondiente al ARN mensajero? (4)

b) ¿Cuál será el codón de la prolina (Pro)? (2) ¿y en el caso de la alanina (Ala)? (2). Razone la respuesta. (2)


Junio 2011
Propuesta 4 /2011.
4.- a) Dado el siguiente fragmento de ADN monocatenario

3’…TAC GGA GAT TCA AGA GAG …5’ y del correspondiente ADN mutante

3’…TAC GGG ATT CAA GAG AG…5’ ¿Qué tipo de mutación se ha producido? (3)

b) ¿La mutación incluida en el apartado (a) puede conllevar alteraciones graves?, razona la respuesta. (2)

c) Indicar qué son las aneuploidías y euploidías. (2)

d) Poner tres ejemplos de agentes mutágenos exógenos. (3)
Septiembre 2011 Propuesta 3/2011.
4. Observa el siguiente segmento de ADN:

5’ G C T T C C C A A 3’

3’ C G A A G G G T T 5’

a) Escribe la molécula de ARN que se transcribiría a partir de este segmento. Considera que la ARN polimerasa usa la hebra superior como molde cuando va a sintetizar ARN. Marca los extremos 5’ y 3’ del ARN. (2)

b) Consultando el código genético, escribe la secuencia de aminoácidos que se produciría al traducir este ARN. Marca los extremos carboxilo y amino de este

péptido. (2)

c) Repite la operación asumiendo ahora que la hebra usada como molde por la ARN polimerasa es la inferior. (4)

d) Con esta información, ¿Podrías saber a ciencia cierta cuál de las dos cadenas de este fragmento de ADN se usa como molde? Explica por qué. (2)
Junio 2012 Propuesta nº 1/ 2012.
4.- a) Indique las funciones de las siguientes enzimas que participan en la replicación del ADN: helicasa y topoisomerasa. (2)

b) ¿Qué es la transcripción? Indique y explique brevemente sus etapas. (5)

c) Transcriba la siguiente secuencia de ADN (2)

5’- GCCGTATGCCCA TAG-3’

d) ¿Qué nombre reciben las secuencias de inicio a las que se une la ARN polimerasa? (1)
Septiembre 2012 Propuesta nº 4 / 2012.
4.- En relación con la información genética y sus alteraciones:

a) Si un polipéptido tiene 110 aminoácidos, indica cuántos nucleótidos tendrá el fragmento del ARNm que codifica a esos aminoácidos. Razone la respuesta. (1)

b) ¿Qué significa que el código genético está degenerado? (1)

c) En un fragmento de ADN que codifica a un polipéptido se produce una mutación puntual, que afecta a un par de bases. Cuando la célula sintetice el polipéptido, a éste le podría haber ocurrido uno de los cuatro hechos siguientes:

1. Que se codifique el mismo aminoácido que el sintetizado antes de la mutación.

2. Que un aminoácido sea sustituido por otro.

3. Que el nuevo polipéptido sintetizado sea más corto.

4. Que el nuevo polipéptido sintetizado sea más largo.

Basándote en tus conocimientos del código genético, explica por qué puede darse cada uno de estos resultados. (8)
Junio 2013 Propuesta nº 3 / 2013.
4.- Responda sobre la traducción:

a) ¿Cuál es la función de estos elementos en dicho proceso?: Ribosoma, ARNm, ARNt, anticodón, sitio peptídico. (5)

b) ¿Cuáles son las fases de dicho proceso? (3)

c) ¿Todas las proteínas recién sintetizadas en eucariotas poseen metionina en su extremo N-terminal? Razone la respuesta. (2)
Septiembre 2013 Propuesta 1 / 2013.
4.- En relación al material genético y su metabolismo:

a) Indique que es el código genético y explique qué quiere decir que está degenerado.

b) Defina el proceso de transcripción e indique sus etapas.

c) Indique qué son los fragmentos de Okazaki y qué enzima se encarga de su síntesis.

d) Señale las modificaciones durante la maduración de un transcrito primario de mRNA

de eucariotas.

e) Escriba la secuencia de mRNA a partir de la siguiente secuencia de DNA e indique cuál es el número máximo de aminoácidos que puede codificar y explíquelo razonadamente:

3’- CCATTGGGCCACCAGGAT-5’
Junio 2014 Propuesta nº 5/ 2014
4. En relación al proceso de replicación:

a) Realice un dibujo e identifique en él todos los componentes que participan tanto en la cadena conductora como en la retrasada. (4)

b) ¿Por qué la síntesis es continua en una de las cadenas y discontinua en la otra? (2)

c) Si se produce una mutación puntual por sustitución de una base por otra distinta, ¿qué

alteraciones esperaríamos encontrar? (2)

d) Cite alguna enzima que participe en la reparación del DNA y señale su función. (2)
Septiembre 2014 Propuesta nº 6/ 2014
4. En relación al material genético conteste a las siguientes cuestiones:

a) Defina los términos replicación semiconservativa y topoisomerasa. (2)

b) Explique dos características del código genético. (2)

c) Defina mutación génica y mutación cromosómica. (2)

d) Indique el orgánulo y las moléculas que intervienen en el proceso de traducción y enumere sus etapas. (4)
Junio 2015 Propuesta nº 6 / 2015
4.- Respecto a la transcripción:

a) Explique en qué consiste e indique el enzima que lleva a cabo este proceso. Cite las etapas en las que se divide este proceso. (5)

b) Indique dos diferencias entre la transcripción en procariotas y en eucariotas. (2)

c) Defina promotor, burbuja de transcripción e intrón. (3)
Septiembre 2015 Propuesta nº 5/ 2015
4.- a) Identificar los procesos celulares (A), (B) y (C) e indicar la ubicación celular de estos procesos en células eucariotas y procariotas. (4)


b) La hebra molde de la región codificante de un gen eucariota que codifica para ARNm contiene la siguiente proporción de bases nitrogenadas: A = 24,7 %, G = 26,0 %, C= 25,7% y T = 23,6 %. Indicar cuál será la proporción de bases del ARNm transcrito primario. ¿Esta proporción será la misma en el ARNm maduro? Razonar la respuesta. (3)

c) Definir los siguientes conceptos: deleción, aneuploidía y poliploidia. (3)

Junio 2016
… alguno daría una pierna…
Septiembre 2016


similar:

Transcripción, traducción, mutaciones iconTranscripción, traducción, mutaciones

Transcripción, traducción, mutaciones iconTranscripción y traducción

Transcripción, traducción, mutaciones iconTranscripción traducción

Transcripción, traducción, mutaciones iconTranscripción Traducción

Transcripción, traducción, mutaciones iconTranscripción Traducción

Transcripción, traducción, mutaciones iconTranscripción traducción

Transcripción, traducción, mutaciones iconTranscripción traducción

Transcripción, traducción, mutaciones iconTranscripción Traducción

Transcripción, traducción, mutaciones iconTranscripción traducción

Transcripción, traducción, mutaciones iconReplicacióN, transcripción y traduccióN




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com