3. Transcripción: síntesis del arn




descargar 77.1 Kb.
título3. Transcripción: síntesis del arn
fecha de publicación19.01.2016
tamaño77.1 Kb.
tipoTranscripción
b.se-todo.com > Química > Transcripción
TEMA 15. LA EXPRESIÓN DEL MENSAJE GENÉTICO: DEL ADN A LAS PROTEÍNAS
1. Cómo se expresan los genes: hipótesis "un gen, una enzima".

2. La expresión del mensaje genético.

3. Transcripción: síntesis del ARN.

3.1 Transcripción en células procariotas.

3.2 Transcripción en células eucariotas.

4. El código genético.

4.1 Características del código genético.

5. Traducción: síntesis de proteínas.

5.1 Etapas del proceso de traducción.

1. CÓMO SE EXPRESAN LOS GENES: HIPÓTESIS "UN GEN, UNA ENZIMA".
Una vez que se estableció la estructura del ADN y el mecanismo de replicación del mismo, faltaba por descubrir cómo el mensaje genético del ADN se materializaba en unas características concretas del organismo.
Para ello hay que remontarse a 1902, cuando el médico inglés Garrod enunció que la alcaptonuria, enfermedad de algunas personas que presentan la orina negra, se debía a un gen recesivo. Mediante análisis químicos llegó a la conclusión de que las personas afectadas no consiguen catabolizar el ácido homogentísico o "alcaptón", que al excretarse en la orina, se oxida en contacto con el aire, tomando un color negro.
Se pudo pasar así de un paralelismo entre gen y carácter, a un paralelismo entre gen y sustancia.
Posteriormente, en 1948, Beadle y Tatum fueron los primeros en establecer la existencia de una relación directa entre la molécula de ADN y la secuencia de aminoácidos de una enzima, y propusieron la hipótesis de "un gen, una enzima". Según la cual, un gen contiene la información para que los aminoácidos se unan en un determinado orden y formen una enzima.
Para establecer esta hipótesis trabajaron con el hongo común del pan, Neurospora crassa, al que sometieron a elevadas dosis de rayos ultravioleta con el fin de provocar alteraciones en su ADN. Aparecieron mutantes que ya sólo sobrevivían si además se añadía el aminoácido arginina, necesario para sintetizar sus proteínas. Habían perdido, por tanto, la capacidad de sintetizar este aminoácido. Otros mutantes necesitaban o arginina o citrulina; y otros, o arginina o citrulina u ornitina. A partir de aquí se dedujo que la síntesis de arginina debía seguir la siguiente ruta metabólica:
Precursor --→ Ornitina --→ Citrulina --→ Arginina


Mediante análisis bioquímicos se pudo confirmar que los diferentes mutantes carecían de determinadas enzimas y que, en cada uno de ellos, aumentaba mucho uno de los componentes de la vía de la arginina. La conclusión era obvia: al faltar una enzima, el metabolismo queda bloqueado en aquella sustancia sobre la cual debía actuar. Los mutantes si podían vivir, si al medio se le añadía la sustancia que no podían sintetizar, o cualquiera de las sustancias derivadas de ellas, ya que si tenían el resto de las enzimas.


Se estableció así un paralelismo entre genes y enzimas (un gen-una enzima). Al alterarse la secuencia de nucleótidos de un gen, falta una enzima.

Posteriormente, puesto que no todas las proteínas son enzimas, esta hipótesis se matizó pasando a "un gen-una proteína". Pero como muchas proteínas están formadas por varios polipéptidos, la hipótesis se transformó en "un gen-una cadena polipeptídica".
Por lo tanto, el gen se define como aquella región del ADN que contiene la información necesaria para sintetizar una molécula de polipéptido.

2. LA EXPRESIÓN DEL MENSAJE GENÉTICO.
Una vez establecido por Beadle y Tatum, en 1948, el paralelismo entre genes y enzimas, surgió otro problema: dado que la síntesis de proteínas se realiza en los ribosomas (situados en el citoplasma) y que el ADN se encuentra en el núcleo, del que no sale, se necesita alguna molécula que actúe como intermediario entre el ADN y los ribosomas. Este papel lo realiza un tipo de de ARN, el ARN mensajero. El proceso de formación de los ARN se denomina transcripción.
En los ribosomas se pasa de una secuencia de ribonucleótidos del ARNm a una secuencia de aminoácidos. Este proceso se denomina traducción, y en él intervienen otros dos tipos de ARN, el ARN ribosómico, componente fundamental de los ribosomas, y el ARN de transferencia, que transporta los aminoácidos hasta los ribosomas.

3. TRANSCRIPCIÓN: SÍNTESIS DEL ARN.
La transcripción es el proceso mediante el cual se copia la información contenida en una región del ADN a moléculas de ARN. La transcripción tiene lugar en el interior del núcleo (en eucariotas) y necesita unos requisitos previos:


  • Una cadena de ADN que actúe como molde. De las dos cadenas de ADN que forman el gen, sólo una, la denominada molde, se transcribe.




  • Enzimas. El proceso está catalizado por las ARN polimerasas, que unen nucleótidos mediante enlaces fosfodiéster, siempre en sentido 5' → 3'.




  • Ribonucleótidos trifosfato (ATP, GTP, CTP, y UTP).


Existen algunas diferencias entre la síntesis de ARN en las células procariotas y las eucariotas.


3.1 TRANSCRIPCIÓN EN CÉLULAS PROCARIOTAS.
En las células procariotas hay una única ARN polimerasa y necesita dos factores: sigma (σ) y rho (ρ).

Se pueden distinguir 4 etapas:


  • Iniciación.


En primer lugar, la ARN polimerasa se asocia a una subunidad proteica, llamada factor sigma, que permite al enzima reconocer y fijarse a una región concreta del ADN, denominada promotor, rica en timina y adenina (hay dos secuencias típicas: TTGACA y TATAAT).
A continuación, la ARN polimerasa desenrolla, aproximadamente, una vuelta de hélice, para permitir la polimerización de ARN a partir de una sola hebra que utiliza como patrón.
Posteriormente se libera el factor sigma.


  • Elongación.


Empieza ahora la adición de ribonucleótidos (a razón de 40 por segundo) para formar el ARN. La ARN polimerasa avanza a lo largo de la cadena de ADN "leyéndola" en sentido 3' --→ 5', mientras va sintetizando ARN en sentido 5' --→ 3'.
La enzima selecciona el ribonucleótido trifosfato cuya base es complementaria con la de la cadena de ADN que actúa como molde y lo une, mediante un enlace éster, desprendiéndose un grupo pirofosfato (PPi)



  • Terminación.


Existen también señales de terminación en el ADN molde que son reconocidas por la ARN polimerasa y que desencadenan la separación de la enzima, del ADN y del ARN transcrito.
Se han descrito dos mecanismos de terminación, en uno de ellos se precisa un factor rho y en otro no se precisa.


    • Terminación independiente de ρ. La señal de terminación en el ADN es una secuencia de bases palindrómica (se lee igual de derecha a izquierda que de izquierda a derecha) rica en G y C, seguidas de varias A, que origina al final del ARN una horquilla por complementariedad de bases. Esto favorece su separación del ADN y la interrupción de la transcripción.

    • Terminación dependiente de ρ. Se basa en la presencia en el ARN de otra secuencia específica, rica en C y pobre en G. Esta secuencia interacciona con una proteina llamada rho, que empieza a desplazarse sobre el ARN (en sentido 3') provocando la desnaturalización del híbrido, liberando el ARN e interrumpiendo la transcripción.




  • Maduración.


Si lo que se sintetiza es un ARNm no hay maduración, la cadena se puede utilizar directamente para la síntesis proteica. De hecho, ésta suele comenzar sin que la transcripción haya finalizado por completo.
Sin embargo, los ARN transcritos que originarán los ARNr y ARNt requieren un proceso adicional de maduración para ser funcionales. Primero hay un transcrito primario, que luego sufre una serie de cortes y empalmes.
A los transcritos que darán lugar a ARNt, una vez escindidos, se les añaden los nucleótidos del extremo terminal (-CCA).
3.2 TRANSCRIPCIÓN EN CÉLULAS EUCARIOTAS.
El proceso de transcripción, en este caso, es más complejo, ya que:


  • Existen 3 tipos de ARN polimerasas:




    • ARN polimerasa I. Transcribe la información correspondiente a los ARN ribosómicos (excepto el 5S).

    • ARN polimerasa II. Se encarga de la transcripción de los genes que originan los ARN mensajeros.

    • ARN polimerasa III. Produce los ARN transferentes, el ARN ribosómico 5S y la transcripción de los genes que portan información para las histonas.




  • Por otra parte, hay que tener en cuenta que en eucariontes, un gen consta de fragmentos sin sentido (intrones) y fragmentos con sentido, que llevan información para la síntesis proteica (exones). De ahí que sea necesario un proceso de maduración del ARN recién sintetizado, en el que se eliminen los intrones y se empalmen los exones. Excepcionalmente, hay genes, como los de las histonas, que no presentan intrones.


Al igual que en procariontes, la síntesis de ARNm se lleva a cabo en varias fases:

  • Iniciación.


El lugar de comienzo de la transcripción está marcado por una región promotora donde se fija la ARN polimerasa II, y que tiene unas secuencias específicas: CAAT o TATA.


  • Elongación.


La cadena de ARN crece en sentido 5' ---> 3'. Cuando se han unido los primeros 30 nucleótidos, se añade al extremo 5' una "caperuza" constituida por 7-metil-guanosín-trifosfato, que durante la traducción será una señal de reconocimiento de inicio de lectura.


  • Finalización.


Existe una secuencia en el ADN (TTATTT) que indica el final de la transcripción. A continuación, sobre el extremo 3' del ARN recién sintetizado se añaden unos 200 ribonucleótidos de adenina, la llamada cola poli-A, por acción de la enzima poli-A polimerasa.


  • Maduración.


El ARN transcrito primario aún no es funcional, para transformarse en ARNm debe sufrir un proceso de maduración. La transformación más importante consiste en la eliminación de los intrones y en la unión de los exones mediante un mecanismo que se conoce con el nombre de splicing (del inglés, empalme).
En este proceso intervienen la enzima ribonucleoproteína pequeña nuclear (RNPpn) o espliceosoma. Es una enzima que tiene una parte proteica y un ARN. Este último posee secuencias complementarias de las de los dos extremos de los intrones, por lo que puede aparearse con ellos, provocar su curvatura y su extracción.
El ARNt y el ARNr presentan también procesos de maduración. En el ARNt cabe destacar la adición del triplete CCA en el extremo 3'.



4. EL CÓDIGO GENÉTICO
Una vez conocida la función de intermediario que realiza el ARNm entre el ADN y las proteínas, quedaba por dilucidar cómo la secuencia de nucleótidos del ARN se podía traducir en una secuencia de aminoácidos. El problema que se planteó fue cómo pasar de un lenguaje de 4 letras (A, G, C y U) a otro formado por 20 letras (los 20 aminoácidos que forman las proteínas). Se necesitaba un "diccionario" con el que poder realizar la traducción; este diccionario es el código genético.
¿Cuántas bases codificarán un aminoácido?

Si fuera una base por aminoácido, sólo se podrían codificar 4, con 2 bases por aminoácido, el resultado sería 42= 16, no es suficiente. Sin embargo, si 3 bases codifican un aminoácido, las combinaciones posibles son 43= 64; sobran tríos para los 20 aminoácidos. Evidentemente habrá aminoácidos que son codificados por más de un triplete.
Experimentalmente* se comprobó que realmente eran 3 bases las que codifican un aminoácido. Los tripletes de bases del ARNm reciben el nombre de codones (los tripletes del ADN correspondientes son los codógenos). Existen 61 codones codificadores de aminoácidos y 3 (UAA, UAG y UGA, llamados sin sentido) que señalan el final del mensaje y no especifican ningún aminoácido. Hay también un codón (AUG) que, además de codificar para el aminoácido metionina, es la señal de comienzo.
* Severo Ochoa descubrió en 1955 la enzima polinucleótido fosforilasa, capaz de sintetizar ARNm a partir de nucleótidos difosfato sin necesidad de un molde de ADN. Así, partiendo de un medio en el que sólo había UDP, se sintetizaba un ARNm llamado poli-U (...UUUUUUUUU....)

Basándose en estos trabajos Nirenberg, en 1961, dedujo que el triplete de bases UUU codificaba para el aminoácido fenilalanina, el CCC para prolina y el AAA para lisina. Posteriormente se descifró el resto de los tripletes , gracias a los investigadores Kornberg y Khorana.

4.1 CARACTERÍSTICAS DEL CÓDIGO GENÉTICO.



  • Es universal. Es el mismo código para todos los organismos conocidos, incluidos los virus; así, por ejemplo, el codón UUG codifica para el aminoácido leucina, tanto en los procariontes como en los eucariontes, lo mismo ocurre con todos los codones. Este hecho indica que el código ha tenido un solo origen evolutivo.

Recientemente se ha descubierto que esta universalidad tiene excepciones: concretamente, las mitocondrias, algunos protozoos y los micoplasmas (bacterias) utilizan u código genético ligeramente diferente.


  • El código genético está degenerado. Este término indica que la mayor parte de los aminoácidos, a excepción de la metionina y el triptófano, están codificados por más de un codón (generalmente sólo se diferencian en la última letra). Esto supone una ventaja, puesto que un cambio de un nucleótido, en muchas ocasiones, puede no alterar el orden de los aminoácidos de una proteína.




  • Es un código sin solapamientos. Los tripletes están dispuestos de manera lineal y continua, sin que entre ellos existan espacios y sin que compartan ninguna base nitrogenada.



5. TRADUCCIÓN: SÍNTESIS DE PROTEÍNAS
Una vez transcrito el ADN, la molécula de ARNm formada contiene la información necesaria para la síntesis de una proteína. Este proceso recibe el nombre de traducción y se lleva a cabo en los ribosomas.

La traducción consiste en unir los aminoácidos en el orden definido por los codones del ARNm. Los aminoácidos son transportados hasta los ribosomas por un ARNt específico para cada uno de ellos; este ARNt se une por su anticodón al codón complementario del ARNm.
La traducción se desarrolla de la misma manera en las células procariotas y eucariotas, aunque existen algunas diferencias. Se describe a continuación el proceso en procariotas, donde ha sido mejor estudiado.
5.1 ETAPAS DEL PROCESO DE TRADUCCIÓN.


  • Activación de los aminoácidos.


Antes de que se inicie la síntesis de proteínas es preciso que los aminoácidos que van a ser unidos se activen. En esta fase previa, que tiene lugar en el citoplasma y no en los ribosomas, cada aminoácido se une a una molécula de ARNt específica para dar lugar a un aminoacil-ARNt. Esta unión la realiza la enzima aminoacil-ARNt-sintetasa y requiere energía (ATP).
Aminoacil-ARNt-

sintetasa

Aminoácido + ARNt + ATP -----------------------→ Aminoacil-ARNt + AMP + PPi
El aminoácido queda unido por su grupo carboxilo al extremo 3' del ARNt (concretamente al grupo -OH del extremo 3' del último nucleótido, que siempre lleva adenina).


  • Traducción propiamente dicha.


A) INICIACIÓN.
En primer lugar, el ARNm se une por su extremo 5' a la subunidad menor del ribosoma.

A continuación se fija el primer aminoacil ARNt, cuyo anticodón es UAC (complementario al codón iniciador, AUG).

El aminoácido unido a este primer ARNt es la formil metionina (aunque en los eucariontes es la metionina). Todas las proteínas inician su síntesis con uno de estos aminoácidos, pero posteriormente suelen ser eliminados.
Por último a este complejo de iniciación (subunidad pequeña del ribosoma + el ARNm + el primer aminoacil-ARNt) se le une la subunidad mayor del ribosoma.
La porción de ARNm cubierta por el ribosoma corresponde a dos codones. Sobre el primero de ellos, AUG, ya está situado el aminoacil-ARNt correspondiente, en el lugar denominado sitio P (de peptidil, ya que es el lugar donde se localiza el ARNt que lleva unida la cadena peptídica en formación). La zona donde se encuentra el segundo codón es el sitio A (de aminoacil, ya que es el lugar en el que se acopla cada nuevo aminoacil-ARNt).
El proceso de iniciación requiere la ayuda de unos factores proteicos de iniciación (FI) y precisa energía, que se obtiene por la hidrólisis del GTP (formándose GDP + P).

B) ELONGACIÓN.
La elongación consiste en el alargamiento de la cadena proteica y se inicia cuando un segundo aminoacil-ARNt, cuyo anticodón es complementario al codón situado a continuación del iniciador, "entra" en el ribosoma y ocupa el sitio A que estaba libre.

El siguiente paso es la formación de un enlace peptídico entre los dos aminoácidos (soltándose el primer aminoácido de su ARNt), gracias a la enzima peptidil transferasa, localizada en la subunidad mayor del ribosoma.

A continuación se produce la translocación del ribosoma, es decir, se desplaza a lo largo del ARNm en sentido 5' -----> 3'. Como este desplazamiento es exactamente de tres bases, el primer ARNt abandona el ribosoma, y el peptidil-ARNt, que todavía se mantiene unido a su codón, pasa a ocupar el sitio P, quedando el sitio A libre. Sobre él se fijará un nuevo aminoacil- ARNt, y se irá alargando la cadena proteica.

El proceso de elongación requiere unos factores de elongación (FE) y energía, que la proporciona el GTP.
C) TERMINACIÓN.


La terminación de la cadena proteica tiene lugar cuando el ribosoma llega a un lugar del ARNm donde se encuentra un codón de terminación (UAA, UGA o UAG), que no es reconocido por ningún ARNt y sí por unos factores de liberación (FR), de naturaleza proteica, que se sitúan en el sitio A y hacen que la peptidil-transferasa separe, por hidrólisis, la cadena polipeptídica del ARNt.

También en este proceso se utiliza la energía que proporciona el GTP.



Al final del proceso de traducción se libera:

      • La cadena proteica que, conforme se ha ido sintetizando, ha adquirido su estructura secundaria y terciaria características.

      • Las dos subunidades ribosómicas separadas.

      • El ARNm, que generalmente se destruye inmediatamente. En ocasiones se degrada según es "leido" por los ribosomas.


La velocidad de síntesis proteica es alta (se pueden unir hasta 1400 aminoácidos por minuto) lo que da idea de la eficacia del sistema. Por otra parte, tanto en procariotas como en eucariotas, las cadenas de ARNm suelen ser "leidas" por más de un ribosoma simultáneamente (polirribosomas o polisomas), lo cual permite un ahorro de tiempo considerable en la síntesis de muchas copias de la misma proteína.




ACTIVIDADES
1.- Explica lo que significa la sentencia: "un gen, una enzima".
2.- Explica las diferencias que hay entre la transcripción del ARNm en procariotas y en eucariotas.
3.- Aún antes de que se descifrara el código genético, se creía que éste estaba degenerado. ¿Podrías explicar por qué?
4.- Diferencia entre los siguientes pares de términos: traducción/transcripción y codón/anticodón.
5.- Indica los tres tipos de ARN, señalando el papel que desempeñan en la síntesis de proteínas.
6.- En la hemoglobina humana, la cadena beta tiene una longitud de 146 aminoácidos. ¿Cuál es la longitud mínima (en número de nucleótidos) de ARNm necesaria para sintetizar esta proteína?
7.- ¿Qué aminoácidos poseen el mayor número de codones?
8.- Al analizar el ADN de un organismo extraterrestre hipotético, se ha observado que posee las mismas bases que el ADN de los organismos terrestres, si bien sus proteínas contienen 64 tipos de aminoácidos distintos. ¿Qué diferencias crees qué pueden existir entre el código genético del organismo extraterrestre y el de los organismos terrestres?
9.- Una hebra de ADN es: 5'...ATGCCATACGGAACC...3', Escribe la hebra complementaria. ¿A cuántos aminoácidos podría dar lugar la traducción de este fragmento? (se supone que todos los codones tienen traducción a aminoácido). Escribe el ARN mensajero a que daría lugar la transcripción.

10.- Si se tiene el siguiente péptido: arg-lys-pro-met, y se sabe que las moléculas de ARNt empleadas en su síntesis tienen los siguientes anticodones:

3'-GGU-5'; 3'-GCU-5'; 3'-UUU-5'; 3'-UAC-5'

Determina la secuencia de nucleótidos del ADN para la cadena molde del gen que codifica para ese péptido.
11.- ¿Qué secuencias nucleotídicas de ADN pueden codificar el siguiente tripéptido?

H2N-Lys-Met-Glu-COOH
12.- ¿Qué secuencias nucleotídicas de ADN pueden codificar el siguiente tripéptido?

HOOC-Lys-Met-Glu-NH2
13.- Se representa un fragmento de ADN; las flechas indican el sentido de lectura:

-->-->-->-->-->-->-->-->-->-->

TACAAAGGCCATGATTCACGACGTTTTGAG

Responde razonadamente a las siguientes preguntas utilizando el código genético.

a) Escribe la secuencia del ARNm derivado del ADN.

b) Escribe la secuencia de aminoácidos de la proteína sintetizada.

c) ¿Cómo se denominan los procesos implicados en los dos apartados anteriores?

d) Si se conociese la secuencia de aminoácidos de una proteína, ¿se podría averiguar la secuencia de bases del ADN que la codifica?
14.- Utiliza la tabla del código genético y completa los espacios en blanco.



_ _ _


T _ _


_ _ _


_ _ _


ADN


_ _ _


_ _ _


C A A


_ _ _


ADN


_ _ _


_ G U


_ _ U


_ _ _


ARNm


_ _ _


_ _ _


_ _ _


A U U


Anticodón


Met


-----


-----


-----


Aminoácido


15.- Indica en qué tripletes de ARNm, de los que codifican la Gly, es más probable que la sustitución al azar de una sola base:

a) Codifique Ser

b) Sea un codón sin sentido

c) Codifique Met
16.- ¿Qué función desempeñan los siguientes elementos en el proceso de traducción?

a) Aminoacil-ARNt-sintetasa

b) Sitio peptídico


17. Compara una célula procariota y otra eucariota indicando en qué parte de las mismas tienen lugar los siguientes procesos:

a) Replicación del material genético.

b) Transcripción del material genético.

c) Traducción del ARNm.

d) Síntesis del ARN ribosómico.

18.- Supongamos la hebra de ADN: 3'...AATACAAAT...5'. Durante la transcripción de la misma hay un error de tal manera que frente al nucleótido C se sitúa otro C en vez de G. ¿Se modificará la secuencia peptídica codificada por la hebra?
ACTIVIDADES PAU


19.- Realice un esquema general de cómo se lleva a cabo la expresión de la información genética, describiendo brevemente los procesos implicados en esta expresión y los pasos de que consta cada uno de ellos. (Junio 2001-Opción A)
20.- Redacte un texto en el que se relacionen de forma coherente los siguientes términos: aminoácidos, poros nucleares, ARN mensajero, ARN transferente, ribosomas, código genético, ADN y proteínas. (Septiembre 2003- Opción B)
21.- Explique las funciones de los distintos tipos de RNA que participan en la síntesis de proteínas.
22.- Defina los siguientes conceptos: replicación, transcripción y traducción. ¿En qué parte de la célula procariota y eucariota tienen lugar estas funciones celulares? Describa cómo se lleva a cabo la transcripción.




23.- Observe la figura adjunta y responda razonadamente a las siguientes cuestiones (Junio 2001- Opción B):

  1. ¿Qué proceso representa el esquema? Identifique los elementos señalados con las letras A y B, indicando cuáles son sus principales semejanzas y diferencias.

  2. Indique la finalidad, dónde se realiza y describa las etapas del proceso que representa el esquema. Indique que significado tienen en el esquema las anotaciones 5’ y 3’


26.- A la vista de la imagen, conteste a las siguientes cuestiones (Junio 2002-Opción B):



  1. Indique razonadamente de qué proceso se trata. ¿En qué lugar de la célula se produce? ¿Cómo afectaría a este proceso una elevación brusca de la temperatura por encima de los 80º C?

  2. Explique la composición y estructura de la molécula resultante. ¿Cuáles son las posibles funciones de la molécula formada?


____________________________________________________________


Biología. Transcripción y traducción

similar:

3. Transcripción: síntesis del arn iconTranscripción y la formación de proteinas gracias a los arn y los...

3. Transcripción: síntesis del arn iconTranscripción y la formación de proteinas gracias a los arn y los...

3. Transcripción: síntesis del arn iconTranscripción y la formación de proteinas gracias a los arn y los...

3. Transcripción: síntesis del arn iconTranscripción y la formación de proteinas gracias a los arn y los...

3. Transcripción: síntesis del arn iconTranscripción: síntesis de una molécula de arn a partir de ribonucleótidos,...

3. Transcripción: síntesis del arn icon3. Transcripción y maduración del arn (Pág. 248-250)

3. Transcripción: síntesis del arn iconLa transcripción organización del genoma en procariotas y eucariotas. Maduración del arn

3. Transcripción: síntesis del arn iconLa transcripción consiste en copiar la información del adn en forma de arn

3. Transcripción: síntesis del arn icon4. El Adn nunca sale del núcleo hacia el citoplasma durante la síntesis...

3. Transcripción: síntesis del arn iconTranscripción. Procesamiento de los arn




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com