 Online Supplementary Resources: Supplemental Tables
Comparative population genetics of aquatic turtles in the desert
S. E. McGaugh
Table S1. Number of individuals sampled for each population at each locus. All sequencing was done in Trachemys taylori. The subscripted number represents Trachemys scripta elegans. One additional T. s. elegans was found at Charcos Prietos. This individual was sequenced for Cyt b and RAG-1 and genotyped with microsatellites. No other sampling took place at Charcos Prietos. The T. s. elegans found in the Churince system was at the small pond at Ejido San Marcos. Localities are listed in order from West to East. Trachemys were genotyped at eight microsatellite loci. Apalone were genotyped at 10 microsatellite loci.
Population Cytb Control Region ND4 RAG-1 Microsat-Trachemys Microsat-Apalone
Churince 81 1 81 591 18
Ant 4 3 1 4 20 5
ELE 124 123 195 4
RM 4 1 8 25 18
TC 3 4 4 13 11
LGa 4 1 1 5 26 20
AMG 3 2 3 3 23 17
Table S2. List of loci and primers designed from raw whole-genome shot-gun 454 reads of Apalone atra for this study. Ap5 was not used because it was not polymorphic. Ap7 and Ap12 did not amplify well. All other markers amplified and were polymorphic in a panel of individuals from across the Cuatro Ciénegas basin. Ap13 and Ap8 were not used in this study because allele sizes conflicted with pooling of PCR products during genotyping.
Read name from Repeat Expected New Primer sequence Best blast hit
raw 454 data motif Size name
GHWVN0X02I68ZN ACATA 234bp Ap1_For TGCTTTCTCTGACAGCTGGA Chrysemys picta BAC clone CHY3-60H12
Ap1_Rev TCGCTTGATCATTGTCTTCG
GHWVN0X02GVYDC ATCT 150 Ap2_For ACCATTGCTCCTTGTTCTGC Chrysemys picta BAC clone CHY3-4H12
Ap2_Rev GGAGAAGGGTCCAGATACCA
GHWVN0X02FM310 CTC 199 Ap3_For TGCAGTGCAGACATACCCTCT Chrysemys picta BAC clone CHY3-11H12
Ap3_Rev TTGAAGTCTGGAAAACATGACC
GHWVN0X02HK7JX TGC 160 Ap4_For GATGGAGCAGAACCTCAACA Chrysemys picta BAC clone CHY3-23H12
Ap4_Rev AACCAGCACCGAGTACATGA
GHWVN0X02IAH93 AC 150 Ap5_For ATGCCACAGGTGGGGAAC Pelodiscus sinensis microsatellite Psi010
Ap5_Rev GGCAATGTGGAGAGTATCTTTCT
GHWVN0X02JXNNK ACGC 162 Ap6_For GAATGTTTCAGGAGTGGTGGA No sufficient matches found
Ap6_Rev CCTTCTTGCAAAAGCAGCAG
GHWVN0X02F1V2A AGAT 221 Ap7_For TGACATCTGCCTTAGCACTTG No sufficient matches found
Ap7_Rev TCCTGTCCTGCGTTAATCAC
GHWVN0X02JAYHC TGAG 211 Ap8_For GTTGTGCCCACGAAAGCTC No sufficient matches found
Ap8_Rev GAATGAGCAATCCTGAGGTG
GHWVN0X02FNQ0J TCTA 224 Ap9_For TCCTGTGTTTCAAAACAATCCA No sufficient matches found
Ap9_Rev CAGTGCCAGCTTCTTCATCA
GHWVN0X02GPFWE TAGA 231 Ap10_For TGCTCTTTGTGTCAGGGTTCT No sufficient matches found
Ap10_Rev AGCTGGGGATGGAGCTTAAC
GHWVN0X02F8A7F TCTT 170 Ap11_For GGGCAAAAAGCCAACATATC No sufficient matches found
Ap11_Rev CTGTCGTCCCTCTGGAAAAG
GHWVN0X02I3LKK CA 108 Ap12_For TTCTGGATCAGTCCATTTTCC No sufficient matches found
Ap12_Rev TTGCCTCGCTTCTAGTCCTC
GHWVN0X02F9S4D CAT 132 Ap13_For TTGCCATCATTTTAGGTCCTC No sufficient matches found
Ap13_Rev ACCTTTGTTGCTGCCCTGTA
GHWVN0X02HYV4B CTAA 194 Ap14_For CCATGTGCTACTGGAGCTGA No sufficient matches found
Ap14_Rev GGAGCTCCACTCAAAGGAAG
GHWVN0X02JFB58 TATC 150 Ap15_For GAAACAAGATGGCAGACAACC No sufficient matches found
Ap15_Rev GAGCCCTATTTGCCCTCATT
Table S3. Linkage disequilibrium statistics for all loci used for population genetic analysis of Apalone. Statistics were generated in Genepop and calculated with a dememorization number of 10,000; 100 batches; and 10,000 iterations per batch. The probability values given in the table have not been corrected for multiple testing. None remain significant at α = 0.05 after Bonferroni or sequential Bonferroni correction.
Locus pair χ2 df P-value
A11 & A2 26.66569 12 0.00863
A1 & A3 24.35656 12 0.018184
A14 & A9 20.046005 12 0.066221
A14 & A1 18.07604 12 0.113401
A1 & A2 16.84517 12 0.155515
A1 & A9 16.569263 12 0.166531
A15 & A11 16.411004 12 0.173128
A14 & A6 16.400937 12 0.173555
A14 & A4 13.552882 10 0.19438
A10 & A2 18.11595 14 0.201551
A11 & A9 12.68369 10 0.241899
A11 & A4 12.202897 10 0.271707
A3 & A9 14.437292 12 0.273659
A14 & A11 14.158682 12 0.29069
A14 & A3 16.077736 14 0.30865
A15 & A10 15.442597 14 0.348584
A4 & A1 10.551256 10 0.39353
A4 & A6 9.696989 10 0.467468
A11 & A6 8.86981 10 0.544502
A2 & A6 9.912099 12 0.623672
A15 & A14 11.483693 14 0.64769
A11 & A10 9.49429 12 0.660232
A10 & A9 9.257115 12 0.680827
A3 & A6 9.177879 12 0.687667
A1 & A6 8.093763 12 0.777761
A15 & A9 8.054364 12 0.780868
A15 & A1 7.919181 12 0.791414
A15 & A2 9.455325 14 0.800824
A10 & A1 7.789462 12 0.801359
A15 & A3 9.023487 14 0.829543
A10 & A3 8.964399 14 0.833324
A6 & A9 7.30184 12 0.837039
A3 & A2 8.702786 14 0.849606
A10 & A6 7.028656 12 0.855714
A4 & A9 4.840275 10 0.901589
A14 & A10 7.17128 14 0.927907
A15 & A4 4.134468 10 0.941077
A2 & A9 5.312808 12 0.946707
A4 & A3 3.933557 10 0.950295
A11 & A1 3.704405 10 0.959698
A10 & A4 3.61552 10 0.96303
A14 & A2 5.510317 14 0.977368
A11 & A3 3.712654 12 0.988081
A4 & A2 2.403605 10 0.992207
A15 & A6 2.907439 12 0.996163
Table S4. Linkage disequilibrium statistics for all loci used for population genetic analysis of Trachemys taylori from Genepop calculated with a dememorization number of 10,000; 100 batches; and 10,000 iterations per batch. The probability values given in the table have not been corrected for multiple testing because none were significant at α = 0.05.
Locus pair χ2 df P-value
D90 & D70 10.618433 14 0.715717
D90 & B67 23.023357 14 0.059891
D70 & B67 4.4679 14 0.991929
D90 & D62 9.484833 14 0.798796
D70 & D62 4.216572 14 0.994016
B67 & D62 18.163222 14 0.199448
D90 & D79 13.608636 14 0.479256
D70 & D79 9.338858 14 0.80875
B67 & D79 15.74654 14 0.329097
D62 & D79 10.217239 14 0.746135
D90 & CP10 14.002681 14 0.449511
D70 & CP10 8.297727 14 0.873245
B67 & CP10 7.867105 14 0.896134
D62 & CP10 15.18138 14 0.365869
D79 & CP10 3.883787 14 0.996126
D90 & D93 8.773549 14 0.845278
D70 & D93 15.69692 14 0.332231
B67 & D93 16.236577 14 0.299141
D62 & D93 11.356068 14 0.657865
D79 & D93 11.054017 14 0.681787
CP10 & D93 6.924226 14 0.937593
D90 & B8 7.97692 6 0.239799
D70 & B8 4.652912 6 0.589036
B67 & B8 1.535048 6 0.957133
D62 & B8 2.872946 6 0.824616
D79 & B8 7.032993 6 0.317807
CP10 & B8 1.473064 4 0.831402
D93 & B8 1.280552 6 0.972719
Table S5. Allele statistics for Apalone and Trachemys taylori within the Cuatro Ciénegas basin displayed per locus per population calculated in GenAlEx version 6. Any T. s. elegans samples are not included. N = average number of individuals genotyped per locus, Na= number of alleles, Ho= observed heterozygosity, He = expected heterozygosity, F = fixation index, FIS.
Apalone A11 A15 A4 A1 A14 A3 A2 A6 A10 A9
HetDef p-value <0.001 0.576 0.570 0.881 0.009 0.329 0.042 <0.001 0.026 0.164
Churince Na 4 4 2 5 4 2 9 9 5 8
N = 17.5 Ho 0.111 0.444 0.167 0.875 0.611 0.333 0.824 0.778 0.824 0.882
He 0.610 0.372 0.153 0.738 0.616 0.401 0.692 0.787 0.651 0.804
F 0.818 -0.195 -0.091 -0.185 0.008 0.169 -0.190 0.012 0.266 -0.097
Anteojo Na 4 2 1 2 3 2 3 3 3 4
N = 4.8 Ho 0.500 0.800 0.000 0.400 1.000 0.000 0.800 0.600 0.750 0.600 He 0.656 0.480 0.000 0.480 0.620 0.320 0.640 0.460 0.594 0.660
F 0.238 -0.667 --- 0.167 -0.613 1.000 -0.250 -0.304 -0.263 0.091
El Mojarral Este Na 2 3 1 4 4 2 3 5 2 5
N = 4 Ho 0.250 0.250 0.000 0.750 0.500 0.750 0.500 0.500 0.250 1.000
He 0.219 0.531 0.000 0.688 0.563 0.469 0.406 0.750 0.219 0.781
F -0.143 0.529 --- -0.091 0.111 -0.600 -0.231 0.333 -0.143 -0.280
Rio Mesquites Na 6 4 4 5 5 2 5 9 5 7
N = 18 Ho 0.389 0.444 0.500 0.667 0.611 0.500 0.556 0.556 0.722 0.667 He 0.693 0.465 0.427 0.715 0.619 0.461 0.721 0.835 0.674 0.731
F 0.439 0.043 -0.170 0.067 0.012 -0.084 0.229 0.335 -0.071 0.089
Tío Candido Na 2 2 2 3 2 2 3 5 2 5
N = 10.8 Ho 0.000 0.455 0.364 0.900 0.364 0.400 0.182 0.727 0.091 1.000 He 0.165 0.483 0.496 0.655 0.496 0.320 0.169 0.764 0.087 0.719
F 1.000 0.060 0.267 -0.374 0.267 -0.250 -0.073 0.049 -0.048 -0.391
Los Gatos Na 3 5 4 4 4 2 8 6 3 6
N = 19.2 Ho 0.000 0.750 0.550 0.833 0.250 0.500 0.750 0.526 0.167 0.650
He 0.194 0.709 0.486 0.688 0.306 0.375 0.825 0.795 0.292 0.723
F 1.000 -0.058 -0.131 -0.211 0.184 -0.333 0.091 0.338 0.429 0.100
Antiguos Mineros Na 5 5 3 4 3 2 5 8 5 5
N = 17 Ho 0.235 0.765 0.471 0.647 0.471 0.294 0.529 0.588 0.529 0.588 He 0.753 0.680 0.524 0.631 0.493 0.389 0.739 0.694 0.716 0.753
F 0.687 -0.125 0.102 -0.025 0.046 0.244 0.283 0.152 0.261 0.218
Trachemys D90 D70 B67 D62 D79 CP10 D93 B8
HetDef p-value 0.638 0.092 0.664 0.406 0.184 0.215 0.002 0.008
Churince +JS Na 4 10 4 4 6 8 2 1
N = 55.8 Ho 0.333 0.765 0.644 0.286 0.644 0.680 0.491 0.000
He 0.345 0.814 0.636 0.270 0.584 0.645 0.497 0.000
F 0.035 0.060 -0.012 -0.060 -0.103 -0.055 0.013 ---
Anteojo Na 3 9 4 4 7 5 3 1
N = 19.5 Ho 0.105 0.789 0.750 0.350 0.750 0.500 0.421 0.000
He 0.101 0.831 0.621 0.344 0.725 0.433 0.483 0.000
F -0.041 0.050 -0.207 -0.018 -0.034 -0.156 0.129 ---
El Mojarral Este Na 3 8 5 3 5 6 6 1
N = 17.8 Ho 0.500 0.889 0.632 0.444 0.684 0.533 0.438 0.000
He 0.387 0.847 0.735 0.461 0.722 0.560 0.656 0.000
F -0.291 -0.049 0.141 0.037 0.052 0.048 0.333 ---
Rio Mesquites Na 3 10 5 5 6 5 2 2
N = 23 Ho 0.600 0.818 0.800 0.609 0.800 0.571 0.480 0.040
He 0.530 0.860 0.746 0.562 0.718 0.663 0.493 0.113
F -0.131 0.048 -0.072 -0.082 -0.114 0.138 0.026 0.645
Tío Candido Na 4 13 5 4 4 6 3 3
N = 24.4 Ho 0.667 0.870 0.692 0.480 0.680 0.652 0.292 0.160
He 0.563 0.849 0.617 0.604 0.574 0.626 0.369 0.218
F -0.183 -0.024 -0.122 0.205 -0.185 -0.042 0.209 0.265
Los Gatos Na 3 8 5 7 6 4 3 1
N = 12.1 Ho 0.167 1.000 0.923 0.692 0.846 0.500 0.417 0.000
He 0.156 0.793 0.710 0.666 0.746 0.414 0.517 0.000
F -0.067 -0.261 -0.300 -0.040 -0.135 -0.208 0.195 ---
Antiguos Mineros Na 3 10 4 7 7 4 6 2
N = 22.1 Ho 0.348 0.762 0.435 0.864 0.762 0.682 0.591 0.087
He 0.363 0.820 0.453 0.768 0.762 0.643 0.588 0.159
F 0.042 0.071 0.040 -0.125 0.000 -0.061 -0.005 0.452
T. scripta elegans Na 6 7 8 6 6 7 6 8
N = 6 Ho 1.000 0.600 0.833 1.000 0.667 0.833 0.833 0.857
He 0.819 0.780 0.847 0.792 0.792 0.764 0.819 0.857
F -0.220 0.231 0.016 -0.263 0.158 -0.091 -0.017 0
Table S6. Pairwise FST calculated in Arlequin using the number of different alleles as the molecular distance. All p-values have been corrected with sequential Bonferroni. Comparisons that are not significant are in bold. The six largest pairwise FST values are underlined.
Pairwise comparison Trachemys p-value Apalone p-value
Churince-Anteojo 0.09227 <0.0001 0.14757 0.0032
Churince-Antiguos Mineros 0.15513 <0.0001 0.15412 <0.0001
Churince-El Mojarral Este 0.05536 0.0001 0.10454 0.0075
Churince-Los Gatos 0.06879 0.0001 0.26451 <0.0001
Churince-Rio Mesquites 0.07136 <0.0001 0.07385 <0.0001
Churince- Tío Candido 0.15878 <0.0001 0.28169 <0.0001
Anteojo-Antiguos Mineros 0.1644 <0.0001 0.09446 0.0180
Anteojo-El Mojarral Este 0.04073 0.0183 0.22784 0.0180
Anteojo-Los Gatos 0.05865 0.0044 0.2149 <0.0001
Anteojo-Rio Mesquites 0.07778 0.0035 0.14273 0.0001
Anteojo- Tío Candido 0.12776 <0.0001 0.36388 0.0028
El Mojarral Este-Antiguos Mineros 0.10117 <0.0001 0.1499 0.0084
El Mojarral Este-Los Gatos 0.02208 0.0788 0.23207 0.0001
El Mojarral Este-Rio Mesquites 0.04302 0.0042 0.04927 0.0734
El Mojarral Este- Tío Candido 0.08253 <0.0001 0.36525 0.0042
Los Gatos-Antiguos Mineros 0.02169 0.0808 0.10569 <0.0001
Rio Mesquites-Antiguos Mineros 0.10767 <0.0001 0.08214 <0.0001
Rio Mesquites-Los Gatos 0.05025 0.0055 0.17777 <0.0001
Rio Mesquites- Tío Candido 0.05015 <0.0001 0.23204 <0.0001
Tío Candido-Antiguos Mineros 0.12237 <0.0001 0.25334 <0.0001
Tío Candido-Los Gatos <0.06815 0.0001 0.31695 <0.0001
Table S7. Global locus-by-locus Analysis of Molecular Variance as a weighted average over polymorphic loci only. A) Apalone using RST, b) Trachemys taylori using RST. Significance of the variance components was assessed with 30,000 permutations. 95 % CI of the fixation indices were generated by 20,000 bootstrap permutations of the data.
A. Apalone AMOVA using RST
FIS = 0.164 (0.022, 0.310), FST = 0.079(0.050, 0.307), FIT = 0.231(0.152, 0.506).
Source of variation SS Var. comp. Percent var. P-value
Among pops 96453.22 418.539 7.957 0.021
Among ind within pops. 466280.26 796.193 15.136 0.064
Within individuals 362820.000 4045.364 76.907 0.006
Total 92553.582 5260.098
B. Trachemys taylori AMOVA using RST
FIS = 0.073 (-0.010, 0.241), FST = 0.072 (0.004, 0.149), FIT = 0.141 (0.004, 0.354)
Source of variation SS Var. comp. Percent var. P-value
Among pops 17853.362 48.69253 7.2718 <0.001
Among ind within pops. 106431.653 45.53121 6.7997 0.047
Within individuals 95757.500 575.3814 85.9285 <0.001
Total 220042.515 669.6051
Table S8. Global locus-by-locus Analysis of Molecular Variance as a weighted average over polymorphic loci using RST to test for the amount of genetic variation explained by two color morphs of Apalone in the basin. The two populations with the darkest carapace (Anteojo and Tío Candido) and the two populations with the lightest carapace (Churince and Los Gatos) were classified as separate groups, and this AMOVA included data from these four populations only. Significance of the variance components was assessed with 30,000 permutations. 95 % CI of the fixation indices were generated by 20,000 bootstrap permutations of the data. FCT was -0.010 (-0.245, 0.067), indicating that carapace color did not explain any of the variance in the genetic data, but variance among populations, among color groups [0.143 (0.044, 0.544)] was a significant factor in explaining molecular variance. FIS = 0.139 (-0.078, 0.290), FIT = 0.255 (0.123, 0.607).
Apalone AMOVA using RST
Source of variation SS Var. comp. Percent var. P-value
Among color morphs 16227.850 -112.548 -3.404 0.535
Among pops. within color morphs 37611.351 709.842 21.467 <0.003
Among individuals within pops 190476.274 600.426 18.158 0.139
Within individuals 156517.5 3078.156 74.546 0.027
Total 400832.976 4129.196
Table S9. Average probability of each cluster value over five runs by STRUCTURE v2.3.3 for turtles in Cuatro Ciénegas, Coahuila, Mexico. Details of each model are provided in the text. The value with the highest LnP(K) is denoted by bold text, the model favored by ∆K is underlined.
Entire Basin
K LnP(K)
Apalone T. taylori T. taylori+T. scripta elegans
1 -2709.92 -3361.0 -3826.98
2 -2556.32 -3244.1 -3617.62
3 -2422.56 -3206.7 -3519.04
4 -2355.12 -3194.5 -3484.36
5 -2307.82 -3161.9 -3447.04
6 -2316.64 -3139.7 -3444.73
7 -2303.80 -3145.1 -3447.33
8 -2340.52 -3169.8 -3486.63
Subsets of basin
K LnP(K)
Apalone-West Apalone-East T. taylori-East
1 -575.16 -2156.58 -2393.76
2 -547.20 -2004.24 -2348.16
3 -560.16 -1912.46 -2328.62
4 -565.36 -1856.16 -2305.36
5 -- -1811.42 -2305.62
6 -- -1875.54 -2325.44
Table S10. Straight-line distance (km) between sampling locations. A dummy site located northwest of the tip of the Sierra San Marcos was used (see Howeth et al. 2008).
Churince 0
Anteojo 8.176 0
El Mojarral 4.090 5.149 0
Rio Mesquites 7.386 6.277 3.360 0
Tío Candido 9.753 11.699 6.912 5.921 0
Los Gatos 16.943 15.979 13.232 10.155 8.908 0
Antiguos Mineros 21.951 23.602 19.113 17.385 12.233 10.972 0
Churince Anteojo ElMojaE RioMes TíoCand LosGatos AntiguosMineros
S11. Critical values of M for the modified Garza-Willamson statistics given in Table 1.
Locality Apalone Mcrit Trachemys Mcrit
Churince 0.5230 0.5871
Anteojo 0.4041 0.6265
El Mojarral Este 0.3826 0.5168
Rio Mesquites 0.5216 0.5380
Tío Candido 0.4800 0.5384
Los Gatos 0.5297 0.4832
Antiguos Mineros 0.5183 0.5307
Total species 0.6189 0.6334
S12. Modified Garza-Willamson statistic for Terrapene coahuila data generated for a previous study (Howeth et al. 2008). This statistic compares the numbers of alleles in a population to the range of alleles to identify population bottlenecks. The G-W statistic ranges from zero to one, with smaller numbers being indicative of a bottleneck. Churince = Laguna Grande and Rio Mesquites = Las Salinas in original paper by Howeth et al. 2008.
Locality Mean s.e. Mcrit
Churince 0.643 (0.214) 0.503
Rio Mesquites 0.704 (0.235) 0.527
Tío Candido 0.734 (0.245) 0.538
Charcos Prietos 0.730 (0.243) 0.547
Pozas Azules 0.770 (0.257) 0.541
Los Gatos 0.675 (0.225) 0.533
Antiguos Mineros 0.612 (0.204) 0.540
Average across populations 0.696 (0.044) 0.532
Total species 0.992 (0.024) 0.635
References
Howeth JG, McGaugh SE, Hendrickson DA (2008) Contrasting demographic and genetic estimates of dispersal in the endangered Coahuilan box turtle: a contemporary approach to conservation. Molecular Ecology 17 (19):4209-4221. doi:10.1111/j.1365-294X.2008.03904.x |
