Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study




descargar 26.8 Kb.
títuloTable chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study
fecha de publicación26.02.2016
tamaño26.8 Kb.
tipoDocumentos
Table S1. Chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study.

Microsatellite locus

Chromosome for O. aries

Primer sequence

Conc. MgCl2

Aling.

Temp.

Reference

OarFCB266

25

Fwd_5'GGCTTTTCCACTACGAAATGTATCCTCAC

Rev_5'CACCACATACCAAACACACAGCCTGC

1mM

58 ºC

Crawford et al., 1994

OarFCB128

2

Fwd_5'ATTAAAGCATCTTCTCTTTATTTCCTCGC

Rev_5'CAGCTGAGCAACTAAGACATACATGCG

1mM

60 ºC

Crawford et al., 1994

MAF48

5

Fwd_5'TCACTAAACCAGGGGCGG

Rev_5'GAGGCAGGCAAAATCAGAAC

1mM

56 ºC

Kappes et al., 1997

MAF36

22

Fwd_5'CATATACCTGGGAGGAATGCATTACG

Rev_5'TTGCAAAAGTTGGACACAATTGAGC

1mM

56 ºC

Crawford et al. 1995

BM848

15

Fwd_5'TGGTTGGAAGGAAAACTTGG

Rev_5'CCCTCTGCTCCTCAAGACAC

3mM

55 ºC

Crawford et al., 1995

BM1818

20

Fwd_5'AGCTGGGAATATAACCAAAGG

Rev_5'AGTGCTTTCAAGGTCCATGC

3mM

55 ºC

Bishop et al., 1994

MAF209

17

Fwd_5'TCATGCACITAAGTATGTAGGATGCTG

Rev_5'GATCACAAAAAGTTGGATACAACCGTGG

1mM

56 ºC

Buchanan and Crawford, 1992

D16S3

12

Fwd_5'GCTTTCAGAAATAGTTTGCATTCA

Rev_5'ATCTTCACATGATATTACAGCAGA

2mM

58 ºC

Crawford et al., 1995

BM2113

2

Fwd_5'GCTGCCTTCTACCAAATACCC

Rev_5'CTTCCTGAGAGAAGCAACACC

1mM

56 ºC

Crawford et al., 1995

D12S4

12

Fwd_5'CCTTTCAAAAACACGGAAATTCGGGGG

Rev_5'CTTCAGGCATACCCTACACCACATG

3mM

56 ºC

Kappes et al., 1997

AGLA293

3

Fwd_5'GAAACTCAACCCAAGACAACTCAAG

Rev_5'ATGACTTTATTCTCCACCTAGCAGA

1mM

56 ºC

Crawford et al., 1995

MGTG4B

4*

Fwd_5'GAGCAGCTTCTTTCTTTCTCATCTT

Rev_5'GCTCTTGGAAGCTTATTGTATAAAG

2mM

56 ºC

Steffen and Eggen, 1993

* Chromosome location reported for Bos taurus.


Table S1 references
Bishop MD, Kappes SM, Keele JW, Stone RT, Sunden SL, et al. (1994) A genetic linkage map for cattle. Genetics 136: 619-639.
Buchanan FC, Crawford AM (1992) Ovine dinucleotide repeat polymorphism at the MAF209 locus. Anim Genet 23: 83.
Crawford AM, Montgomery GW, Pierson CA, Brown T, Dodds, K.G., Sunden, et al. (1994) Sheep linkage mapping: nineteen linkage groups derived from the analysis of paternal half-sib families. Genetics 137: 573-579.
Kappes SM, Keele JW, Stone RT, McGraw RA, Sonstegard TS, et al. (1997) A second-generation linkage map of the bovine genome. Genome Res 7: 235-249.
Steffen P, Eggen A, Dietz AB, Womack JE, Stranzinger G, et al. (1993) Isolation and mapping of polymorphic microsatellites in cattle. Anim Genet 24: 121-124.

similar:

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconTable S2 Species names, voucher information, localities of origin,...

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconLoci genéticos y alelos

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconChapter I: international position of latin america1

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconReferences for Volume One

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconRoewer, Nothnagel et al., Continent-wide decoupling of y-chromosomal...

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconSupplementary indormation on populations analysed for both rdna and...

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconSupplementary indormation on populations analysed for both rdna and...

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconTable of Content

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconSupplemental Table 2

Table chromosomal position, primer sequences, MgCl2 concentration, alignment temperature, and references of the microsatellite loci used in this study iconTable language sources




Todos los derechos reservados. Copyright © 2019
contactos
b.se-todo.com